Query (optional)   in Class  

GrainGenes Marker Report: 1882-1F/1R

[ Printable Version ]  [ Submit comment/correction ]

Locus
1882-1F/1R
Type
Microsatellite
Probe
1882-1F/1R
Remark
Locus on Oat-KxO_PCR-2 is 940 bp
Locus on Oat-KxO_PCR-36 is 885 bp



Probe
1882-1F/1R
Locus
1882-1F/1R
Reference
ReferencePal N et al. (2002) Development and characterization of microsatellite and RFLP-derived PCR markers in oat Crop Science 42:912-918.
Type
STS
PCR primers
1F 5' CAACACCAGTTCAAGATTACCCTATGAAGA
1R 5' TGCTCCTGATCTTAAGGTCCATAAAGTCG
STS size
> 800
Amplification Conditions
55
Specificity
Polymorphism among 13 Avena species is Yes
Source Species
Avena sp.