Query (optional)   in Class  

GrainGenes Marker Report: ABC00703_L01R01

[ Printable Version ]  [ Submit comment/correction ]

Locus
ABC00703_L01R01
Synonym
Synonymscsnp00703



Probe
ABC00703_L01R01
Locus
scsnp00703
Data at Germinate
ABC00703
Remarks
Estimated product size = unknown
BarleySNP type = SNP From EST
Technology platform used = PyrosequencingTM Technology
Affymetrix contig name = abc00703
Type
STS
PCR primers
5' TGGCTATGCTTTTGGTAGACG
5' CTCAGGTCCAAACCCAAGAA
Source Species
Hordeum vulgare
Data Source
Russell, Joanne



Locus for Probe
scsnp00703
Type
SNP
Synonym
Other nameSNP703
SynonymABC00703_L01R01
Chromosome
7H
Map
Hordeum-Consensus2005-SNP-7H99.912
[ Show all 7 ]
[ Show Nearby Loci ]
Map Data
Barley, Abiotic QTL Consensus
[ Show all 7 ]
Species
Hordeum vulgare
Probe
ABC00703_L01R01
Reference
ReferenceSzucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140.
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source
Russell, Joanne
Remark
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Oregon Wolfe Barleys