Query (optional)   in Class  

GrainGenes Marker Report: ABC153

[Submit comment/correction]

Locus
ABC153
Type
RFLP
Synonym
SynonymABC153
ABG153
Chromosome
2H
Chromosome Arm
2HL
Map
Barley-consensus-2003-2H140.1
[ Show all 21 ]
[ Show Nearby Loci ]
QTL with Locus Marker
QDon.umn-2H.2
QFhs.umn-2H.7
QHD.umn-2H.3
Map Data
Barley consensus
[ Show all 21 ]
Probe
ABC153
Reference
ReferenceWenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
ReferenceMesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318.
Data Source
Blake, Tom05.04.19
Langridge, Peter J.
Remark
Number of populations contributing to the placement of ABC153 in the Barley, Consensus 2006 DArT maps = 2
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs
Xabc153



Probe
ABC153
Locus
ABC153
[ Show all 15 ]
External Databases
DDBJ
EMBL
GenBank
Remarks
Steptoe malt cDNA
Type
cDNA
STS
PCR primers
GCC TCT GCC GCT GGA ACT AC
AAA CAC CTC CTG GCT CTC AG
STS primers
5' GGTTTGAGGACATGGTTGTTTC
5' GCCTCTGCCGCTGGAACTAC
STS size
ca. 330
Amplification Conditions
STS annealing temperature 52-55 oC
Sequence
L43924
ABC153
Linkage Group
Group 2
2
Source Species
Hordeum vulgare
Source Germplasm
Steptoe (barley)
Source Tissue
malt
Insert Size
0.4
Clone Vector
pBS
Excision Enzyme
EcoRI
Clone Location
GrainGenes Probe Repository
Kleinhofs, Andris
Clone Authority
Blake, Tom
Hayes, Patrick M.
Data Source
Blake, Tom95.08.24
ATMI92.09
Kleinhofs, Andris96.05.08
Kuenzel, Gottfried00.03



Locus for Probe
BB001F7
Probe
ABC153



Locus for Probe
HD004N9
Probe
ABC153
ABC164



Locus for Probe
HD005D1
Probe
ABC153
ABC164



Locus for Probe
HD014N20
Probe
ABC153
ABC164



Locus for Probe
HD030K13
Probe
ABC153
pTtksuD7



Locus for Probe
HD032P16
Probe
ABC153
ABC164



Locus for Probe
HD082K6
Probe
ABC153



Locus for Probe
HD084J20
Probe
ABC153



Locus for Probe
HD092G11
Probe
ABC153



Locus for Probe
HI010B14
Probe
ABC153



Locus for Probe
HI013L19
Probe
ABC153



Locus for Probe
HI065K19
Probe
ABC153



Locus for Probe
HI075I9
Probe
ABC153



Locus for Probe
Xabc153
Type
RFLP
Map
Tm-Dubcovsky2-2A56.7
[ Show Nearby Loci ]
Map Data
T. monococcum, DV92 x G3116
Probe
ABC153
Possible Orthologs
ABC153

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.