Query (optional)   in Class  

GrainGenes Marker Report: ABC156

[ Printable Version ]  [ Submit comment/correction ]

Locus
ABC156
Type
RFLP
Synonym
SynonymABC156A
ABC156d
Chromosome
1H
7H
Chromosome Arm
7HS
Map
Barley-Consensus-7H-13.1
Hordeum-CxH-6H80.49
Hordeum-DxM-2H17.6
Hordeum-Zhedar2-FHB-QTL-1H27.8
[ Show Nearby Loci ]
Map Data
Barley consensus
Barley, CxH
Barley, Dicktoo x Morex
Barley, Zhedar2, FHB QTL
Probe
ABC156
Possible Orthologs
ABC156(A)
[ Show all 23 ]



Probe
ABC156
Locus
Sr33
[ Show all 25 ]
Synonym
SynonymHAR35_37808
Remarks
Steptoe malt cDNA
Type
cDNA
STS
STS primers
5' TTACGGGATCAAAGCTGAGGC
5' GACAAGCAACACCAACCAAGC
STS size
197
Amplification Conditions
STS annealing temperature 58-60 oC
Sequence
BQ548054
ABC156
ABC156-5
Polymorphism
ABC156 XbaI
ABC156 EcoRI
ABC156 EcoRV
ABC156 HindIII
ABC156 DraI
Linkage Group
Groups 2,3,1
2
3
Source Species
Hordeum vulgare
Source Germplasm
Steptoe (barley)
Source Tissue
malt
Insert Size
0.3
Clone Vector
pBS
Excision Enzyme
EcoRI
Clone Location
GrainGenes Probe Repository
Kleinhofs, Andris
Clone Authority
Hayes, Patrick M.
Image
ABC156 SO autoradiogram
Data Source
Graner, Andreas94.03.08
ATMI92.09
Kleinhofs, Andris96.05.08
Kuenzel, Gottfried00.03



Locus for Probe
ABC156(A)
Type
RFLP
Map Data
Barley, GxH
Probe
ABC156
Possible Orthologs
ABC156
[ Show all 23 ]



Locus for Probe
ABC156(B)
Type
RFLP
Map
Hordeum-GxH-1H29.13
[ Show Nearby Loci ]
Map Data
Barley, GxH
Probe
ABC156
Possible Orthologs
ABC156
[ Show all 23 ]



Locus for Probe
ABC156(C)
Type
RFLP
Map
Hordeum-GxH-5H99.02
[ Show Nearby Loci ]
Map Data
Barley, GxH
Probe
ABC156
Possible Orthologs
ABC156
[ Show all 23 ]



Locus for Probe
ABC156(D)
Type
RFLP
Map
Hordeum-GxH-6H94.96
[ Show Nearby Loci ]
Map Data
Barley, GxH
Probe
ABC156
Possible Orthologs
ABC156
[ Show all 23 ]



Locus for Probe
ABC156(E)
Type
RFLP
Map
Hordeum-GxH-2H31.14
[ Show Nearby Loci ]
Map Data
Barley, GxH
Probe
ABC156
Possible Orthologs
ABC156
[ Show all 23 ]



Locus for Probe
ABC156A
Type
RFLP
Synonym
SynonymABC156
Chromosome
2H
5H
Map
Barley-consensus-2003-5H27.9
[ Show all 13 ]
[ Show Nearby Loci ]
In QTL
QMe.DiMo-2H
Map Data
Barley consensus 2
[ Show all 13 ]
Probe
ABC156
Reference
ReferenceWenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source
Blake, Tom05.04.19
Langridge, Peter J.
Remark
Number of populations contributing to the placement of ABC156A in the Barley, Consensus 2006 DArT maps = 1
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs
ABC156
[ Show all 23 ]



Locus for Probe
ABC156Aa
Type
RFLP
Chromosome
2H
Map
Hordeum-StMo-SNP-2H32.05
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SNP
Probe
ABC156
Reference
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Possible Orthologs
ABC156
[ Show all 23 ]



Locus for Probe
ABC156B
Type
RFLP
Chromosome
1H
6H
Map
Barley-consensus-2003-6H60.9
Hordeum-Bins-1H25
Hordeum-FxS-FHB-QTL-1H2.6
[ Show Nearby Loci ]
Map Data
Barley consensus 2003
Barley, BinMap 2005
Barley, FxS, FHB QTL
Probe
ABC156
Reference
ReferenceMesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318.
Data Source
Kleinhofs, Andris
Langridge, Peter J.
Remark
This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin
Possible Orthologs
ABC156
[ Show all 23 ]



Locus for Probe
ABC156C
Type
RFLP
Chromosome
3H
Map
Barley-Consensus2-3H41
Hordeum-Bins-3H62.7
Hordeum-StMo-SNP-3H50
Hv-Consensus2006-Marcel-3H51.62
Hv-Integrated2009-3H63.4
[ Show Nearby Loci ]
Map Data
Barley consensus 2
[ Show all 7 ]
Probe
ABC156
Reference
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Remark
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs
ABC156
[ Show all 23 ]



Locus for Probe
ABC156d
Type
RFLP
Synonym
SynonymABC156
Chromosome
7H
Map
Barley-Consensus2-7H59.6
[ Show all 16 ]
[ Show Nearby Loci ]
In QTL
QBgnm.StMo-7H.1
QBgsk.StMo-7H.1
Map Data
Barley consensus 2
[ Show all 16 ]
Probe
ABC156
Reference
ReferenceWenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
ReferenceLi JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Data Source
Blake, Tom05.04.19
Remark
Number of populations contributing to the placement of ABC156D in the Barley, Consensus 2006 DArT maps = 1
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Igri x Franka
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Igri x Franka
Possible Orthologs
ABC156
[ Show all 23 ]



Locus for Probe
abc156
Type
RFLP
Map
Wheat, Yr genes and QTL 1A22.7
Wheat, Yr genes and QTL 1B14
Wheat, Yr genes and QTL 1D15.1
[ Show Nearby Loci ]
Map Data
Wheat, Yr genes and QTL
Probe
ABC156
Possible Orthologs
ABC156
[ Show all 23 ]



Locus for Probe
Sr33
Type
Gene
Trait
Chromosome
1D
Chromosome Arm
1DS
1S
Map
1DS, Ae. tauschii30.7
[ Show all 6 ]
[ Show Nearby Loci ]
Map Data
1DS, Ae. tauschii
Triticeae consensus
Wheat genes
Wheat, Synthetic x Opata  [ GBrowser ]
Wheat-2014-Consensus-Ug99-Update
2 Point Data
Centromere/Sr33#1
Rg2/Sr33#1
Sr33/Gli-D1#1
Species
Aegilops tauschii
Triticum aestivum
Probe
ABC156
BARC152
CFD15
Associated Gene
Sr33 (Aegilops)
Sr33 (Triticum)
Gene Class
Reaction to Puccinia graminis Pers.
Reference
ReferenceYu L et al. (2014) A consensus map for Ug99 stem rust resistance loci in wheat. Theoretical and Applied Genetics 127:1561-1581.
[ Show all 6 ]
Data Source
Matthews, David E.
Remark
For map 'Wheat, Synthetic x Opata', position approximated from mapping in another population.
Trait marker abc156, whs179a
Nearby marker on Composite map: Xabc156b, Xwhs179.1
Position on Composite map estimated by GrainGenes.
The location on the 2014 Ug99 Consensus Map is approximate.



Locus for Probe
Xabc156
Type
RFLP
Map
Tm-Dubcovsky2-1A-42
[ Show Nearby Loci ]
Map Data
T. monococcum, DV92 x G3116
Probe
ABC156
Possible Orthologs
ABC156
[ Show all 23 ]



Locus for Probe
Xabc156-1
Type
RFLP
Chromosome Arm
1S
Map
Triticeae-Sorrells-119
[ Show Nearby Loci ]
Map Data
Triticeae consensus
Probe
ABC156
Possible Orthologs
ABC156
[ Show all 23 ]



Locus for Probe
Xabc156-1A
Type
RFLP
Chromosome
1A
Chromosome Arm
1AS
Map
Ta-Synthetic/Opata-1A26.4
Ta-Synthetic/Opata-BARC-1A25.1
Ta-Synthetic/Opata-DR-1A-28.7
Ta-Synthetic/Opata-GPW-1A27.7
Ta-Synthetic/Opata-SSR-1A27.6
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata  [ GBrowser ]
Wheat, Synthetic x Opata, BARC
Wheat, Synthetic x Opata, DR Genes
Wheat, Synthetic x Opata, GPW
Wheat, Synthetic x Opata, SSR
Probe
ABC156
Possible Orthologs
ABC156
[ Show all 23 ]



Locus for Probe
Xabc156-1B
Type
RFLP
Chromosome
1B
Chromosome Arm
1BS
Map
Ta-Synthetic/Opata-1B20.9
Ta-Synthetic/Opata-BARC-1B16.3
Ta-Synthetic/Opata-GPW-1B17.9
Ta-Synthetic/Opata-SSR-1B18
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata  [ GBrowser ]
Wheat, Synthetic x Opata, BARC
Wheat, Synthetic x Opata, GPW
Wheat, Synthetic x Opata, SSR
Probe
ABC156
Remark
Ordered at LOD < 3.0 in map 'Wheat, Synthetic x Opata'.
Possible Orthologs
ABC156
[ Show all 23 ]



Locus for Probe
Xabc156-1D
Type
RFLP
Chromosome
1D
Chromosome Arm
1DS
Map
1DS, Ae. tauschii38.3
[ Show all 7 ]
[ Show Nearby Loci ]
Map Data
1DS, Ae. tauschii
[ Show all 7 ]
Species
Aegilops tauschii
Probe
ABC156
Reference
ReferenceSpielmeyer W et al. (2000) NBS-LRR sequence family is associated with leaf and stripe rust resistance on the end of homoeologous chromosome group 1S of wheat Theoretical and Applied Genetics 101:1139-1144.
Possible Orthologs
ABC156
[ Show all 23 ]



Locus for Probe
Xabc156.3
Type
RFLP
Chromosome
1B
Map
Wheat-Composite2004-1B28
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Probe
ABC156
Possible Orthologs
ABC156
[ Show all 23 ]



Locus for Probe
Xabc156a
Type
RFLP
Chromosome
1D
Map
Wheat-Composite2004-1D7
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Probe
ABC156
Possible Orthologs
ABC156
[ Show all 23 ]



Locus for Probe
Xabc156b
Type
RFLP
Chromosome
1D
Map
Wheat-Composite2004-1D27
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Probe
ABC156
Possible Orthologs
ABC156
[ Show all 23 ]



Locus for Probe
Xabc156c
Type
RFLP
Chromosome
1A
Map
Wheat-Composite2004-1A28
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Probe
ABC156
Possible Orthologs
ABC156
[ Show all 23 ]



Locus for Probe
abc156-1A
Type
RFLP
Chromosome
1A
Probe
ABC156
Possible Orthologs
ABC156
[ Show all 23 ]



Locus for Probe
abc156-1B
Type
RFLP
Chromosome
1B
Probe
ABC156
Possible Orthologs
ABC156
[ Show all 23 ]



Locus for Probe
abc156-1D
Type
RFLP
Chromosome
1D
Probe
ABC156
Possible Orthologs
ABC156
[ Show all 23 ]