Query (optional)   in Class  

GrainGenes Marker Report: ABC165

[ Printable Version ]  [ Submit comment/correction ]

Locus
ABC165
Type
RFLP
Synonym
SynonymABC165
Chromosome
2H
Chromosome Arm
2HL
Map
Barley-consensus-2003-2H140.1
[ Show all 18 ]
[ Show Nearby Loci ]
QTL with Locus Marker
QHt.StMo-2H.2
QLg.StMo-2H.2
Map Data
Barley consensus
[ Show all 18 ]
Probe
ABC165
Reference
ReferenceClose TJ et al. (2009) Development and implementation of high-throughput SNP genotyping in barley. BMC Genomics 10:582.
ReferenceWenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source
Blake, Tom05.04.19
Close, Timothy J.
Langridge, Peter J.
Remark
Number of populations contributing to the placement of ABC165 in the Barley, Consensus 2006 DArT maps = 1
Possible Orthologs
ABC165-2H
ABC165A
ABC165C
ABC165D



Probe
ABC165
Locus
ABC165
ABC165C
ABC165D
ABC165A
ABC165-2H
External Databases
DDBJ
EMBL
GenBank
Remarks
Steptoe malt cDNA
Type
cDNA
STS
PCR primers
CAATGACTTCAAGGGGTCTG
TCCATACCATTCCCATCTAA
Sequence
L43932
Linkage Group
Group 2
2
Source Species
Hordeum vulgare
Source Germplasm
Steptoe (barley)
Source Tissue
malt
Insert Size
0.5
Clone Vector
pBS
Excision Enzyme
EcoRI
Clone Location
GrainGenes Probe Repository
Kleinhofs, Andris
Clone Authority
Blake, Tom
Hayes, Patrick M.
Data Source
Blake, Tom95.08.24
ATMI92.09
Kleinhofs, Andris96.05.08



Locus for Probe
ABC165-2H
Type
RFLP
Map
Hv-SxM-Stein-2H131.58
[ Show Nearby Loci ]
Map Data
Barley, SxM, Stein2006
Probe
ABC165
Possible Orthologs
ABC165
ABC165A
ABC165C
ABC165D



Locus for Probe
ABC165A
Type
RFLP
Chromosome
2H
Map
Hordeum-Consensus2007-SSR-2H135.78
Hv-Consensus2006-Marcel-2H135.78
Hv-Integrated2009-2H132.4
[ Show Nearby Loci ]
Map Data
Barley, Consensus 2006, Marcel
Barley, Consensus 2007, SSR
Barley, Integrated, Marcel 2009
Species
Hordeum vulgare
Probe
ABC165
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
Remark
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs
ABC165
ABC165-2H
ABC165C
ABC165D



Locus for Probe
ABC165C
Type
RFLP
Chromosome
1H
Map
Hordeum-Bins-1H1
[ Show all 8 ]
[ Show Nearby Loci ]
Map Data
Barley, BinMap 2005
[ Show all 8 ]
Species
Hordeum vulgare
Probe
ABC165
Reference
ReferenceSzucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140.
ReferenceWenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
ReferenceMesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318.
Data Source
Kleinhofs, Andris
Remark
Number of populations contributing to the placement of ABC165C in the Barley, Consensus 2006 DArT maps = 1
This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Oregon Wolfe Barleys
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Oregon Wolfe Dom x Rec
Possible Orthologs
ABC165
ABC165-2H
ABC165A
ABC165D



Locus for Probe
ABC165D
Type
RFLP
Chromosome
6H
7H
Map
Hordeum-Bins-6H83
[ Show all 6 ]
[ Show Nearby Loci ]
Map Data
Barley, BinMap 2005
[ Show all 6 ]
Species
Hordeum vulgare
Probe
ABC165
Reference
ReferenceSzucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140.
Data Source
Kleinhofs, Andris
Remark
This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Oregon Wolfe Barleys
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Oregon Wolfe Dom x Rec
Possible Orthologs
ABC165
ABC165-2H
ABC165A
ABC165C