Query (optional)   in Class  

GrainGenes Marker Report: ABC168

[ Printable Version ]  [ Submit comment/correction ]

Locus
ABC168
Type
RFLP
Synonym
SynonymABC168
Chromosome
5H
Chromosome Arm
5HL
Map
Barley-Consensus-5H36.6
[ Show all 14 ]
[ Show Nearby Loci ]
Map Data
Barley consensus
[ Show all 16 ]
Probe
ABC168
Reference
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
ReferenceMesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318.
Remark
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Igri x Franka
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Igri x Franka



Probe
ABC168
Locus
ABC168
HD021C10
Synonym
SynonymHAR35_5989
External Databases
DDBJ
EMBL
GenBank
Remarks
Steptoe malt cDNA
Type
cDNA
STS
PCR primers
GTA AGA ACA AAA CCC AAA AC
GGA GAC CCA GCG GAA GGA GA
STS primers
5' CCCGGTAACTACTTACACCG
5' CGTGGAGCTGGTGTGCGAGA
STS size
223
Amplification Conditions
STS annealing temperature 55-58 oC
Sequence
L43935
ABC168
ABC168-5
Linkage Group
Group 7
Source Species
Hordeum vulgare
Insert Size
0.2
Clone Vector
pBS
Excision Enzyme
EcoRI
Clone Location
Kleinhofs, Andris
Clone Authority
Blake, Tom
Data Source
Graner, Andreas94.03.08
Blake, Tom95.08.24
ATMI92.09
Kuenzel, Gottfried00.03



Locus for Probe
HD021C10
Probe
ABC168