Query (optional)   in Class  

GrainGenes Marker Report: ABC175B

[ Printable Version ]  [ Submit comment/correction ]

Locus
ABC175B
Type
RFLP
Map
Hordeum-KxM-6H89.2
[ Show Nearby Loci ]
Map Data
Barley, KxM
Probe
ABC175
Possible Orthologs
ABC175
[ Show all 8 ]



Probe for Locus
ABC175
Locus
ABC175B
[ Show all 11 ]
Synonym
SynonymHAR35_1958
Type
cDNA
STS
STS primers
5' CAGTTTACAAGTGCAGAGGT
5' GAACAGAAGCAGAAGATCGA
STS size
270
Amplification Conditions
STS annealing temperature 55-58 oC
Sequence
BQ548059
ABC175-5
Source Species
Hordeum vulgare
Data Source
Graner, Andreas94.03.08
Kuenzel, Gottfried00.03