Query (optional)   in Class  

GrainGenes Marker Report: ABC261

[ Printable Version ]  [ Submit comment/correction ]

Locus
ABC261
Type
RFLP
STS
Synonym
SynonymBlp (Hordeum)
Chromosome
1H
Chromosome Arm
1HL
Map
Barley-Consensus-1H100.5
[ Show all 26 ]
[ Show Nearby Loci ]
QTL with Locus Marker
QSsg.HaTR-1H
Map Data
Barley consensus
[ Show all 26 ]
Species
Hordeum vulgare
Probe
ABC261
Associated Gene
Blp (Hordeum)
Gene Class
Black lemma and pericarp
Reference
ReferenceClose TJ et al. (2009) Development and implementation of high-throughput SNP genotyping in barley. BMC Genomics 10:582.
[ Show all 7 ]
Data Source
Blake, Tom05.04.19
Close, Timothy J.
Remark
Number of populations contributing to the placement of ABC261 in the Barley, Consensus 2006 DArT maps = 2
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Oregon Wolfe Barleys
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Oregon Wolfe Dom x Rec
Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs
Xabc261



Gene Associated with Locus
Blp (Hordeum)
Full Name
Black lemma and pericarp
Synonym
SynonymB
Referencevon Wettstein-Knowles P (1993) Barley (Hordeum vulgare) 2N = 14. Genetic maps : locus maps of complex genomes..
Gene Class
Black lemma and pericarp
Allele
Blp (Hordeum)
blp (Hordeum)
Locus
ABC261
Blp
mB
URL
http://ace.untamo.net/cgi-bin/ace/tree/default?class=Gene&name=Blp+(Hordeum)
Chromosome
1H
Image
Barley, Blp (black head) phenotype.1
Barley, Blp (black head) phenotype.2
Barley, blp (non-black head) phenotype
BGS Photo
BGS203a, Black lemma and pericarp  [ BGS Database ]
BGS203b, Black lemma and pericarp  [ BGS Database ]
BGS203c, Black lemma and pericarp  [ BGS Database ]
Data Source
Franckowiak, Jerome D.96.10



Probe
ABC261
Locus
ABC261
HI057G22
HD008L1
Xabc261
ABC261-1H
External Databases
DDBJ
EMBL
GenBank
Type
cDNA
STS
PCR primers
AGGAAGCTCAAGAAGGTGAA
AAAGTCAAGAGTTGCATCAA
Sequence
L43942
ABC261
Source Species
Hordeum vulgare
Clone Location
GrainGenes Probe Repository
Clone Authority
Blake, Tom
Data Source
Blake, Tom95.08.24



Locus for Probe
HD008L1
Probe
ABC261



Locus for Probe
HI057G22
Probe
ABC261



Locus for Probe
ABC261-1H
Map
Hv-SxM-Stein-1H113.1
[ Show Nearby Loci ]
Map Data
Barley, SxM, Stein2006
Probe
ABC261



Locus for Probe
Xabc261
Type
RFLP
Chromosome
1A
Chromosome Arm
1AL
Map
Tm-Dubcovsky-1A42.8
Tm-Dubcovsky2-1A63.5
[ Show Nearby Loci ]
Map Data
T. monococcum, DV92 x G3116
T. monococcum, G1777 x G2528
Probe
ABC261
Possible Orthologs
ABC261