Query (optional)   in Class  

GrainGenes Marker Report: ABC322A

[ Printable Version ]  [ Submit comment/correction ]

Locus
ABC322A
Type
RFLP
Synonym
SynonymABC322
Chromosome
7H
Map
Barley-Consensus2-7H78
[ Show all 10 ]
[ Show Nearby Loci ]
Map Data
Barley consensus 2
[ Show all 10 ]
Probe
ABC322
Reference
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source
Blake, Tom05.04.19
Remark
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs
ABC322B



Probe for Locus
ABC322
Locus
ABC322B
HD084P24
ABC322A
Synonym
SynonymHAR35_8900
External Databases
DDBJ
EMBL
GenBank
Type
STS
PCR primers
ACATTGTTCAGTGCTGATTC
ATCAGGCTGGTATCTGTTTC
Sequence
L43950
ABC322
Polymorphism
ABC322 EcoRI
Source Species
Hordeum vulgare
Clone Location
GrainGenes Probe Repository
Clone Authority
Blake, Tom
Image
ABC322 BROWSSM autoradiogram
Data Source
Blake, Tom95.08.24