Query (optional)   in Class  

GrainGenes Marker Report: ABG072-2H

[ Printable Version ]  [ Submit comment/correction ]

Locus
ABG072-2H
Type
STS
Map
Hv-DxR-Stein-2H120.89
Hv-SxM-Stein-2H100.76
[ Show Nearby Loci ]
Map Data
Barley, OWB, Stein2006
Barley, SxM, Stein2006
Probe
ABG72
Possible Orthologs
ABG072
ABG72



Probe for Locus
ABG72
Locus
ABG72
ABG072
ABG072-2H
Synonym
SynonymHAR35_19063
External Databases
DDBJ
EMBL
GenBank
Type
Genomic
STS
PCR primers
CTGCAACTAATTCCCTTCTA
GATCCTCTAGAGTCGACCTG
Sequence
L44093
ABG72
Linkage Group
2
Source Species
Hordeum vulgare
Insert Size
0.7
Clone Vector
pGEM
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Kleinhofs, Andris
Clone Authority
Blake, Tom
Dahleen, Lynn S.
Data Source
Blake, Tom95.08.24
Kleinhofs, Andris96.05.08