Query (optional)   in Class  

GrainGenes Marker Report: ABG077

[ Printable Version ]  [ Submit comment/correction ]

Locus
ABG077
Type
RFLP
Synonym
SynonymABG77
Chromosome
7H
Map
Hordeum-Bins-7H3.4
Hordeum-Consensus2005-SNP-7H18.997
Hordeum-NABGMP2-7H2.1
Hordeum-QTLConsensus-Abiotic-7H19
Hordeum-QTLConsensus-Agronomic-7H19
[ Show Nearby Loci ]
Map Data
Barley, Abiotic QTL Consensus
Barley, Agronomic QTL Consensus
Barley, BinMap 2005
Barley, Consensus 2005, SNP
Barley, HxT
Probe
ABG77
Reference
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Possible Orthologs
ABG77



Probe for Locus
ABG77
Locus
ABG077
ABG77
External Databases
DDBJ
EMBL
GenBank
Type
STS
PCR primers
GCACAGTAAGTAAGGAGACA
GTTTGTGTGATGGCAGTGTA
Sequence
L44095
ABG77
Source Species
Hordeum vulgare
Clone Authority
Blake, Tom
Image
High resolution map of Rpg1
Data Source
Blake, Tom95.08.24