Query (optional)   in Class  

GrainGenes Marker Report: ABG316A

[ Printable Version ]  [ Submit comment/correction ]

Locus
ABG316A
Type
RFLP
Synonym
SynonymABG316
p13XB(1.1)
Chromosome
3 (3H), Steptoe x Morex
3H
Chromosome Arm
3P (3HS), Steptoe x Morex
Map
Barley-Consensus2-3H1.4
[ Show all 11 ]
[ Show Nearby Loci ]
Map Data
Barley consensus 2
[ Show all 11 ]
Probe
ABG316
p13XB(1.1)
Reference
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
ReferenceLi JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Data Source
Blake, Tom05.04.19
Kleinhofs, Andris96.08
Remark
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs
ABG316
[ Show all 7 ]



Probe for Locus
p13XB(1.1)
Locus
ABG316A
ABG316B
ABG316C
ABG316D
ABG316E
Synonym
Other nameABG316
Clone Location
Kleinhofs, Andris
Data Source
Kleinhofs, Andris96.08



Probe for Locus
ABG316
Locus
ABG316f
[ Show all 8 ]
Synonym
Please seep13XB(1.1)
SynonymHAR35_31000
External Databases
DDBJ
EMBL
GenBank
General Remarks
The 2.4 kb fragment from this clone is ABG319.
Type
Genomic
STS
PCR primers
CCAATTGTGTGAATGGATGT
CGTAAGAAGGAGAAGATGAC
Sequence
L43975
ABG316
Linkage Group
3
Barley 7 (5H)
2
Source Species
Hordeum vulgare
Insert Size
1.1
1
Clone Vector
pUC
Excision Enzyme
EcoRI
HindIII
Clone Location
Kleinhofs, Andris
Clone Authority
Kleinhofs, Andris
Blake, Tom
Kilian, Andrzej
Data Source
Graner, Andreas94.03.08
Blake, Tom95.08.24
Kleinhofs, Andris96.05.08