Query (optional)   in Class  

GrainGenes Marker Report: ABG320

[ Printable Version ]  [ Submit comment/correction ]

Locus
ABG320
Type
RFLP
STS
Synonym
SynonymABG320
Chromosome
7H
Chromosome Arm
7HS
Map
Barley-consensus-2003-7H19.8
[ Show all 21 ]
[ Show Nearby Loci ]
Map Data
Barley consensus
[ Show all 21 ]
Species
Hordeum vulgare
Probe
ABG320
Reference
ReferenceClose TJ et al. (2009) Development and implementation of high-throughput SNP genotyping in barley. BMC Genomics 10:582.
[ Show all 6 ]
Data Source
Blake, Tom05.04.19
Close, Timothy J.
Langridge, Peter J.
Remark
Number of populations contributing to the placement of ABG320 in the Barley, Consensus 2006 DArT maps = 1
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs
ABG320-7H
Xabg320-4B
Xabg320-5D



Probe
ABG320
Locus
ABG320
Xabg320-4B
Xabg320-5D
ABG320-7H
External Databases
DDBJ
EMBL
GenBank
Type
Genomic
STS
PCR primers
GATCCAACAGCAAGGAAAGA
AGACGAGTGGACACATGATG
Sequence
L43979
ABG320
Source Species
Hordeum vulgare
Clone Location
GrainGenes Probe Repository
Clone Authority
Blake, Tom
Data Source
Blake, Tom95.08.24



Locus for Probe
ABG320-7H
Type
STS
Map
Hv-SxM-Stein-7H11.13
[ Show Nearby Loci ]
Map Data
Barley, SxM, Stein2006
Probe
ABG320
Possible Orthologs
ABG320
Xabg320-4B
Xabg320-5D



Locus for Probe
Xabg320-4B
Type
STS
Map
Ta-Synthetic/Opata-GPW-4B50.1
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata, GPW
Probe
ABG320
Possible Orthologs
ABG320
ABG320-7H
Xabg320-5D



Locus for Probe
Xabg320-5D
Type
STS
Map
Ta-Synthetic/Opata-GPW-5D30.2
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata, GPW
Probe
ABG320
Possible Orthologs
ABG320
ABG320-7H
Xabg320-4B