Query (optional)   in Class  

GrainGenes Marker Report: ABG4

[ Printable Version ]  [ Submit comment/correction ]

Locus
ABG4
Type
RFLP
Synonym
SynonymABG004
Chromosome
3H
Chromosome Arm
3HL
Map
Barley-consensus-2003-3H98.9
[ Show all 12 ]
[ Show Nearby Loci ]
QTL with Locus Marker
QHd.DiMo-3H
QS/T.DiMo-3H
Map Data
Barley consensus
[ Show all 14 ]
Species
Hordeum vulgare
Probe
ABG4
Reference
ReferenceWenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
ReferenceLi JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
ReferenceChoi DW et al. (2000) Map locations of barley Dhn genes determined by gene-specific PCR Theoretical and Applied Genetics 101:350-354.
Data Source
Langridge, Peter J.
Remark
Number of populations contributing to the placement of ABG4 in the Barley, Consensus 2006 DArT maps = 2
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Oregon Wolfe Dom x Rec; Igri x Franka
In the Bowman-BC x Calicuchima-sib maps, this locus was originally assigned to a second linkage group on 3H. The distance between ABG453 and ABG4 is an average of 31.2 in the 3 GrainGenes maps containing these loci, and the linkage groups were combined at a distance of 31.2 cM.
Possible Orthologs
ABG004
ABG004-3H
ABG4B
Xabg4
Xabg4-3



Probe
ABG4
Locus
ABG4B
[ Show all 10 ]
Remarks
Shin Ebisu16 gDNA
Type
Genomic
STS
PCR primers
AGC ACC AAA GCA CCT GAA CC
CGG GAG GAG GGG AAG AGG AC
STS primers
5' CTGCCACAAGGAATTTCCGG
5' AGCACCAAAGCACCTGAACCC
STS size
317
Amplification Conditions
STS annealing temperature 55-58 oC
Sequence
L43994
ABG4
ABG004-5
Linkage Group
Group 3
3
Source Species
Hordeum vulgare
Source Germplasm
Shin Ebisu 16
Insert Size
0.5
Clone Vector
pGEM
Excision Enzyme
PstI
Clone Location
Kleinhofs, Andris
Clone Authority
Kleinhofs, Andris
Blake, Tom
Data Source
Graner, Andreas94.03.08
Blake, Tom95.08.24
ATMI92.09
Kleinhofs, Andris96.05.08
Kuenzel, Gottfried00.03



Locus for Probe
HD065L6
Probe
ABG4



Locus for Probe
HD082I16
Probe
ABG4



Locus for Probe
HI065L6
Probe
ABG4



Locus for Probe
HI082I16
Probe
ABG4



Locus for Probe
ABG004
Type
RFLP
Synonym
SynonymABG4
Chromosome
3H
Map
Hordeum-Bins-3H141.7
[ Show all 19 ]
[ Show Nearby Loci ]
In QTL
QNb.StMo-3H.2
Map Data
Barley, Abiotic QTL Consensus
[ Show all 19 ]
Species
Hordeum vulgare
Probe
ABG4
Reference
ReferenceClose TJ et al. (2009) Development and implementation of high-throughput SNP genotyping in barley. BMC Genomics 10:582.
[ Show all 7 ]
Data Source
Blake, Tom05.04.19
Close, Timothy J.
Remark
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Oregon Wolfe Barleys,Igri x Franka
Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs
ABG4
ABG004-3H
ABG4B
Xabg4
Xabg4-3



Locus for Probe
ABG004-3H
Type
RFLP
Map
Hv-IxF-Stein-3H67.36
Hv-SxM-Stein-3H108.07
[ Show Nearby Loci ]
Map Data
Barley, IxF, Stein2006
Barley, SxM, Stein2006
Probe
ABG4
Possible Orthologs
ABG004
ABG4
ABG4B
Xabg4
Xabg4-3



Locus for Probe
ABG4B
Type
RFLP
Map
Hordeum-KxM-4H68.5
[ Show Nearby Loci ]
Map Data
Barley, KxM
Probe
ABG4
Possible Orthologs
ABG004
ABG4
ABG004-3H
Xabg4
Xabg4-3



Locus for Probe
Xabg4
Type
RFLP
Map
Tm-Dubcovsky2-3A35
[ Show Nearby Loci ]
Map Data
T. monococcum, DV92 x G3116
Probe
ABG4
Possible Orthologs
ABG004
ABG4
ABG004-3H
ABG4B
Xabg4-3



Locus for Probe
Xabg4-3
Type
RFLP
Map
Triticeae-Sorrells-3-update75.8
[ Show Nearby Loci ]
Map Data
Triticeae consensus
Probe
ABG4
Possible Orthologs
ABG004
ABG4
ABG004-3H
ABG4B
Xabg4