Query (optional)   in Class  

GrainGenes Marker Report: ABG453-3H

[ Printable Version ]  [ Submit comment/correction ]

Locus
ABG453-3H
Type
STS
Map
Hv-SxM-Stein-3H84.44
[ Show Nearby Loci ]
Map Data
Barley, SxM, Stein2006
Probe
ABG453
Possible Orthologs
ABG453
Xabg453-3



Probe for Locus
ABG453
Locus
ABG453
Xabg453-3
ABG453-3H
General Remarks
Shin Ebisu16 gDNA
Type
Genomic
STS
STS primers
5' GCTATTGACAAGCAATGCC
5' GGTGACGTAGCACGCACTAA
STS size
ca. 1000
Amplification Conditions
STS annealing temperature 58-60 oC
Sequence
BH854357
BH854356
ABG453-5
ABG453-3
Linkage Group
Group 3
Source Species
Hordeum vulgare
Insert Size
1.1
Clone Vector
pBR
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Kleinhofs, Andris
Clone Authority
Kleinhofs, Andris
Data Source
Graner, Andreas94.03.08
ATMI92.09
Kuenzel, Gottfried00.03