Query (optional)   in Class  

GrainGenes Marker Report: ABG460

[ Printable Version ]  [ Submit comment/correction ]

Locus
ABG460
Type
RFLP
Synonym
SynonymABG460
Chromosome
3H
5H
Chromosome Arm
3HS
Map
Barley-consensus-2003-5H93.1
[ Show all 20 ]
[ Show Nearby Loci ]
Map Data
Barley consensus
[ Show all 20 ]
Species
Hordeum vulgare
Probe
ABG460
Reference
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
ReferenceChoi DW et al. (2000) Map locations of barley Dhn genes determined by gene-specific PCR Theoretical and Applied Genetics 101:350-354.
Data Source
Blake, Tom05.04.19
Langridge, Peter J.
Remark
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Oregon Wolfe Barleys,Igri x Franka
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Oregon Wolfe Dom x Rec; Igri x Franka
Possible Orthologs
ABG460-3H
[ Show all 8 ]



Probe
ABG460
Locus
Xabg460-3
[ Show all 9 ]
Synonym
SynonymHAR35_23373
HAR35_30482
External Databases
DDBJ
EMBL
GenBank
Remarks
Shin Ebisu16 gDNA
Type
Genomic
STS
PCR primers
TTG TGT GGT AAA AGT AAA AT
TGG AGG AGA GCG GAA GAG AT
STS primers
5' CAGCGATTACAAGCGTGTAA
5' GGGACGTTCAAATTAACTTG
STS size
380
Amplification Conditions
STS annealing temperature 58-60 oC
Sequence
L44023
ABG460
ABG460-5
ABG460-3
Polymorphism
ABG460 EcoRV
Linkage Group
3S
Source Species
Hordeum vulgare
Insert Size
1.6
Clone Vector
pGEM
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Kleinhofs, Andris
Clone Authority
Kleinhofs, Andris
Blake, Tom
Image
ABG460 SO autoradiogram
Data Source
Graner, Andreas94.03.08
Blake, Tom95.08.24
ATMI92.09
Kuenzel, Gottfried00.03



Locus for Probe
ABG460-3H
Type
STS
Map
Hv-DxR-Stein-3H43.68
Hv-IxF-Stein-3H4.22
Hv-SxM-Stein-3H28.28
[ Show Nearby Loci ]
Map Data
Barley, IxF, Stein2006
Barley, OWB, Stein2006
Barley, SxM, Stein2006
Probe
ABG460
Possible Orthologs
ABG460
[ Show all 8 ]



Locus for Probe
abg460
Type
STS
Map
Wheat, Yr genes and QTL 3A22.3
[ Show Nearby Loci ]
Map Data
Wheat, Yr genes and QTL
Probe
ABG460
Possible Orthologs
ABG460
[ Show all 8 ]



Locus for Probe
Xabg460
Type
RFLP
Chromosome
3A
Map
Wheat-Composite2004-3A69
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Probe
ABG460
Possible Orthologs
ABG460
[ Show all 8 ]



Locus for Probe
Xabg460-3
Type
RFLP
Chromosome Arm
3S
Map
Triticeae-Sorrells-333.3
Triticeae-Sorrells-3-update39.7
[ Show Nearby Loci ]
Map Data
Triticeae consensus
Probe
ABG460
Possible Orthologs
ABG460
[ Show all 8 ]



Locus for Probe
Xabg460-3A
Type
RFLP
Chromosome
3A
Chromosome Arm
3AS
Map
Ta-Synthetic/Opata-3A33.7
Ta-Synthetic/Opata-BARC-3A53.1
Ta-Synthetic/Opata-GPW-3A34.2
Ta-Synthetic/Opata-update-3A64.3
Tm-Dubcovsky2-3A-9.8
[ Show Nearby Loci ]
Map Data
T. monococcum, DV92 x G3116
Wheat, Synthetic x Opata  [ GBrowser ]
Wheat, Synthetic x Opata, BARC
Wheat, Synthetic x Opata, GPW
Wheat, Synthetic x Opata, update
Probe
ABG460
Image
ABG460 SO autoradiogram
Remark
In the population 'T. monococcum, DV92 x G3116,' this locus and Xmwg584-3A were mapped with identical restriction fragments, so the corresponding clones are assumed to be homologous.
Possible Orthologs
ABG460
[ Show all 8 ]



Locus for Probe
Xabg460-4A.1
Type
RFLP
Map
Tm-Dubcovsky2-4A-55.7
[ Show Nearby Loci ]
Map Data
T. monococcum, DV92 x G3116
Probe
ABG460
Remark
In the population 'T. monococcum, DV92 x G3116,' this locus and Xmwg584-4A.1 were mapped with identical restriction fragments, so the corresponding clones are assumed to be homologous.
Possible Orthologs
ABG460
[ Show all 8 ]



Locus for Probe
Xabg460-4A.2
Type
RFLP
Map
Tm-Dubcovsky2-4A50.9
[ Show Nearby Loci ]
Map Data
T. monococcum, DV92 x G3116
Probe
ABG460
Remark
In the population 'T. monococcum, DV92 x G3116,' this locus and Xmwg584-4A were mapped with identical restriction fragments, so the corresponding clones are assumed to be homologous.
Possible Orthologs
ABG460
[ Show all 8 ]



Locus for Probe
abg460-3A
Type
RFLP
Chromosome
3A
Probe
ABG460
Possible Orthologs
ABG460
[ Show all 8 ]