Query (optional)   in Class  

GrainGenes Marker Report: ABG461B

[ Printable Version ]  [ Submit comment/correction ]

Locus
ABG461B
Type
RFLP
STS
Chromosome
6H
7H
Chromosome Arm
6HL
7HL
Map
Hordeum-Bins-6H117
[ Show all 6 ]
[ Show Nearby Loci ]
Map Data
Barley, BinMap 2005
Barley, Consensus 2006, DArT
Barley, FxS, FHB QTL
Barley, HxM/QTL
Barley, KxM
Probe
ABG461
Reference
ReferenceWenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
ReferenceMesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318.
Data Source
Kleinhofs, Andris
Remark
Number of populations contributing to the placement of ABG461B in the Barley, Consensus 2006 DArT maps = 1
This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin
Possible Orthologs
ABG461
[ Show all 8 ]



Probe for Locus
ABG461
Locus
ABG461C
[ Show all 9 ]
Synonym
SynonymHAR35_21952
HAR35_3657
External Databases
DDBJ
EMBL
GenBank
General Remarks
Shin Ebisu16 gDNA
Type
Genomic
STS
PCR primers
TAG AAG TAG AAA AAG GAA CC
GAA GAA CAA CCA ATA GAA TG
STS primers
5' AGTTCAATGTTCACCACAGC
5' CAATGTACCGGACTATTTGG
STS size
283
Amplification Conditions
STS annealing temperature 58-60 oC
Sequence
L44024
ABG461
ABG461-5
ABG461-3
Linkage Group
Group 1
Source Species
Hordeum vulgare
Insert Size
1
Clone Vector
pGEM
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Kleinhofs, Andris
Clone Authority
Kleinhofs, Andris
Blake, Tom
Data Source
Graner, Andreas94.03.08
Blake, Tom95.08.24
ATMI92.09
Kuenzel, Gottfried00.03