Query (optional)   in Class  

GrainGenes Marker Report: ABG64

[ Printable Version ]  [ Submit comment/correction ]

Locus
ABG64
Type
RFLP
Synonym
SynonymABG064
Chromosome
5H
Map
Hordeum-StMo-SNP-5H41.33
Hv-Consensus2006-Marcel-5H36.89
[ Show Nearby Loci ]
Map Data
Barley, Consensus 2006, Marcel
Barley, Steptoe x Morex, SNP
Probe
ABG64
Reference
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Remark
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs
ABG064



Probe
ABG64
Locus
ABG064
ABG64
External Databases
DDBJ
EMBL
GenBank
Type
STS
PCR primers
GGCTGAATCATCCGCTCATA
GGGTATGCATGGACGTGGTC
Sequence
L44079
ABG64
Source Species
Hordeum vulgare
Clone Authority
Blake, Tom
Data Source
Blake, Tom95.08.24



Locus for Probe
ABG064
Type
RFLP
STS
Synonym
SynonymABG64
Chromosome
5H
Map
Hordeum-AxK-5H28
[ Show all 7 ]
[ Show Nearby Loci ]
Map Data
Barley, Abiotic QTL Consensus
[ Show all 9 ]
Probe
ABG64
Reference
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Remark
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex
Possible Orthologs
ABG64