Query (optional)   in Class  

GrainGenes Marker Report: BAGY2CM61s

[ Printable Version ]  [ Submit comment/correction ]

Locus
BAGY2CM61s
Type
SSAP
Chromosome
5H
Map
Hordeum-SxM-SSAP-5H50.1
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
BAGY2CM61
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Probe for Locus
BAGY2CM61
Locus
BAGY2CM61h
[ Show all 23 ]
Reference
ReferenceLeigh F et al. (2003) Comparison of the utility of barley retrotransposon families for genetic analysis by molecular marker techniques Molecular Genetics and Genomics 269:464-474.
General Remarks
Position of retroposon-based primer in the LTR = 5' and 35 nucleotides internal to the LTR terminus
MseI primer (KeyGene code) = CTG (M61)
Type
PCR
STS
PCR primers
BAGY-2-C0589 5' TTCGACACTCTTACTTATCGAAAGG 3'
Mse1 primer M61 5' GATGAGTCCTGAGTAACTG 3'
Amplification Conditions
amplified as Vos et al Nucl Acids Res 23: 4407-4416
Source Species
Hordeum vulgare