Query (optional)   in Class  

GrainGenes Marker Report: BARC1

[Submit comment/correction]

Probe
BARC1
Locus
Xbarc1-5A
Xbarc1
barc1
barc1-5A
Remarks
Contains motif : (TAA)8
BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type
PCR
SSR
PCR primers
5' GCGATGCTTTTGCCTTGTTTCAG 3'
5' GCGGCCCCTTTGACTCTTCATAG 3'
Amplification Conditions
Annealing temperature = 52
Sequence
BV211580
Source Species
Triticum aestivum
Data Source
Ward, Rick



Locus for Probe
barc1
Type
Microsatellite
Map
Durum Wheat, NSGC Lr 5A48.8
Wheat, Yr genes and QTL 5A23.9
Wheat_Yr_2021-5A53.52
[ Show Nearby Loci ]
Map Data
Durum Wheat, NSGC Lr
Wheat, Yr genes and QTL
Wheat, Yr Update, 2021
Probe
BARC1
Possible Orthologs
Xbarc1
Xbarc1-5A
barc1-5A



Locus for Probe
barc1-5A
Type
Microsatellite
Map
Wheat_AB, Meridiano x Claudio 5A_145.9
Wheat_AB_2015_Consensus-5A48.8
[ Show Nearby Loci ]
Map Data
Wheat_AB, Meridiano x Claudio
Wheat_AB_2015_Consensus
Probe
BARC1
Possible Orthologs
Xbarc1
Xbarc1-5A
barc1



Locus for Probe
Xbarc1
Type
Microsatellite
Chromosome
5A
Map
Wheat-Composite2004-5A30
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Probe
BARC1
Possible Orthologs
Xbarc1-5A
barc1
barc1-5A



Locus for Probe
Xbarc1-5A
Type
Microsatellite
Chromosome
5A
Map
Chinese_Spring_Deletion_SSR_5A0.46
CS/SQ1-5A29
T.b.xT.m.-5A18.7
Ta-Synthetic/Opata-BARC-5A34.2
[ Show Nearby Loci ]
Breakpoint Interval
5AL12-0.35-0.57
Map Data
T. boeoticum x monococcum
Wheat, Chinese Spring x SQ1
Wheat, Physical, SSR
Wheat, Synthetic x Opata, BARC
Probe
BARC1
Possible Orthologs
Xbarc1
barc1
barc1-5A

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.