Query (optional)   in Class  

GrainGenes Marker Report: BARC127

[ Printable Version ]  [ Submit comment/correction ]

Probe
BARC127
Locus
Xbarc127-7A
[ Show all 6 ]
Remarks
Contains motif : (CT)19
BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type
PCR
SSR
PCR primers
5' TGCATGCACTGTCCTTTGTATT 3'
5' AAGATGCGGGCTGTTTTCTA 3'
Amplification Conditions
Annealing temperature = 52
Sequence
BV211328
Source Species
Triticum aestivum
Data Source
Ward, Rick



Locus for Probe
barc127
Type
Microsatellite
Map
Durum Wheat, NSGC Lr 7A55.4
Wheat, Yr genes and QTL 6B49
Wheat, Yr genes and QTL 7A14.7
[ Show Nearby Loci ]
Map Data
Durum Wheat, NSGC Lr
Wheat, Yr genes and QTL
Probe
BARC127
Reference
ReferenceLowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157.
Possible Orthologs
Xbarc127
Xbarc127-6B
Xbarc127-7A
barc127-7A
barc127-6B



Locus for Probe
barc127-7A
Type
Microsatellite
Map
Wheat-2014-Consensus-Ug99-Update_7A33.88
Wheat_AB, Ben x PI41025 7A49.4
Wheat_AB_2015_Consensus-7A55.4
[ Show Nearby Loci ]
In QTL
QSl.scau-7A
Map Data
Wheat-2014-Consensus-Ug99-Update
Wheat_AB, Ben x PI41025
Wheat_AB_2015_Consensus
Probe
BARC127
Possible Orthologs
Xbarc127
Xbarc127-6B
Xbarc127-7A
barc127
barc127-6B



Locus for Probe
Xbarc127
Type
Microsatellite
Map
Ta-NxW-7A107.9
Wheat, Avalon x Cadenza 7A24.7
Wheat, UC1110 x PI610750 7A63.7
[ Show Nearby Loci ]
Map Data
Wheat, Avalon x Cadenza
Wheat, Nanda2419 x Wangshuibai
Wheat, UC1110 x PI610750
Probe
BARC127
Reference
ReferenceLowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157.
Possible Orthologs
Xbarc127-6B
Xbarc127-7A
barc127
barc127-7A
barc127-6B



Locus for Probe
Xbarc127-6B
Type
Microsatellite
Chromosome
6B
Map
Ta-SSR-2004-6B47.1
[ Show Nearby Loci ]
Map Data
Wheat, Consensus SSR, 2004
Probe
BARC127
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
Possible Orthologs
Xbarc127
Xbarc127-7A
barc127
barc127-7A
barc127-6B



Locus for Probe
Xbarc127-7A
Type
Microsatellite
Chromosome
7A
Map
Chinese_Spring_Deletion_SSR_7A-0.795
Louise/Penawawa-7A81.2
Ta-SSR-2004-7A43.6
Ta-Synthetic/Opata-BARC-7A45.1
[ Show Nearby Loci ]
Breakpoint Interval
7AS5-0.59-1.00*
Map Data
Wheat, Consensus SSR, 2004
Wheat, Louise x Penawawa
Wheat, Physical, SSR
Wheat, Synthetic x Opata, BARC
Probe
BARC127
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
Possible Orthologs
Xbarc127
Xbarc127-6B
barc127
barc127-7A
barc127-6B



Locus for Probe
barc127-6B
Type
Microsatellite
Chromosome
6B
Probe
BARC127
Possible Orthologs
Xbarc127
Xbarc127-6B
Xbarc127-7A
barc127
barc127-7A