Query (optional)   in Class  

GrainGenes Marker Report: BARC147

[ Printable Version ]  [ Submit comment/correction ]

Locus
barc147
Type
Microsatellite
Map
Durum Wheat, NSGC Lr 3B4.1
Physical-3B7.09
Wheat, Yr genes and QTL 3B6.1
Wheat_2014_i9K_Ug99_PIxLMPG_3B9.1
[ Show Nearby Loci ]
Map Data
3B Physical
Durum Wheat, NSGC Lr
Wheat, Yr genes and QTL
Wheat_2014_i9K_Ug99_PIxLMPG
Probe
BARC147
Possible Orthologs
Xbarc147
[ Show all 8 ]



Probe
BARC147
Locus
Xbarc147-3B
[ Show all 9 ]
Remarks
Contains motif : CA)14
BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type
PCR
SSR
PCR primers
5' GCGCCATTTATTCATGTTCCTCAT 3'
5' CCGCTTCACATGCAATCCGTTGAT 3'
Amplification Conditions
Annealing temperature = 52
Sequence
BV211628
Source Species
Triticum aestivum
Data Source
Ward, Rick



Locus for Probe
barc147-3B
Type
Microsatellite
Map
Wheat_AB, Kofa x UC1113 3B_12.5
Wheat_AB_2015_Consensus-3B4.1
[ Show Nearby Loci ]
Map Data
Wheat_AB, Kofa x UC1113
Wheat_AB_2015_Consensus
Probe
BARC147
Reference
ReferenceLowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157.
Possible Orthologs
barc147
[ Show all 8 ]



Locus for Probe
barc147-3D
Type
Microsatellite
Probe
BARC147
Reference
ReferenceLowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157.
Possible Orthologs
barc147
[ Show all 8 ]



Locus for Probe
Xbarc147-3D
Type
Microsatellite
Map
Wheat, UC1110 x PI610750 3D3.9
[ Show Nearby Loci ]
Map Data
Wheat, UC1110 x PI610750
Probe
BARC147
Reference
ReferenceLowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157.
Possible Orthologs
barc147
[ Show all 8 ]



Locus for Probe
Xbarc147
Type
Microsatellite
Chromosome
3B
Map
Wheat-Composite2004-3B16
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Probe
BARC147
Possible Orthologs
barc147
[ Show all 8 ]



Locus for Probe
Xbarc147-3B
Type
Microsatellite
Chromosome
3B
Map
Chinese_Spring_Deletion_SSR_3B-0.89
[ Show all 7 ]
[ Show Nearby Loci ]
In QTL
QFhs.ndsu-3B
Breakpoint Interval
3BS8-0.78-1.00
Map Data
Durum wheat, Kofa x UC1113
[ Show all 7 ]
Probe
BARC147
Reference
ReferenceLowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157.
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
Possible Orthologs
barc147
[ Show all 8 ]



Locus for Probe
Xbarc147.1
Type
Microsatellite
Map
Ta-NxW-3B15.2
[ Show Nearby Loci ]
Map Data
Wheat, Nanda2419 x Wangshuibai
Probe
BARC147
Possible Orthologs
barc147
[ Show all 8 ]



Locus for Probe
Xbarc147.2
Type
Microsatellite
Map
Ta-NxW-3D12.6
[ Show Nearby Loci ]
Map Data
Wheat, Nanda2419 x Wangshuibai
Probe
BARC147
Possible Orthologs
barc147
[ Show all 8 ]



Locus for Probe
XbarcM147-2B
Type
Microsatellite
Map
Chinese_Spring_Deletion_SSR_2B0.945
[ Show Nearby Loci ]
Breakpoint Interval
2BL6-0.89-1.00
Map Data
Wheat, Physical, SSR
Probe
BARC147
Remark
'M' indicates that this probe is monomorphic in Synthetic, Opata, and Chinese Spring.
Possible Orthologs
barc147
[ Show all 8 ]