Query (optional)   in Class  

GrainGenes Marker Report: BARC20

[Submit comment/correction]

Probe
BARC20
Locus
Xbarc20
[ Show all 6 ]
Remarks
Contains motif : (TAA)21
BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type
PCR
SSR
PCR primers
5' GCGATCCACACTTTGCCTCTTTTACA 3'
5' GCGATGTCGGTTTTCAGCCTTTT 3'
Amplification Conditions
Annealing temperature = 53
Sequence
BV211638
Source Species
Triticum aestivum
Data Source
Ward, Rick



Locus for Probe
barc20
Type
Microsatellite
Map
Durum Wheat, NSGC Lr 4B41.3
Wheat, Yr genes and QTL 4B37.2
Wheat, Yr genes and QTL 7B91.7
[ Show Nearby Loci ]
Map Data
Durum Wheat, NSGC Lr
Wheat, Yr genes and QTL
Probe
BARC20
Reference
ReferenceLowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157.
Possible Orthologs
Xbarc20
Xbarc20-4B
Xbarc20-7B
barc20-4B
barc20-7B



Locus for Probe
barc20-4B
Type
Microsatellite
Map
Wheat_AB, Colosseo x Lloyd 4B27.8
Wheat_AB, Latino x MG5323 4B41
Wheat_AB, Meridiano x Claudio 4B50.4
Wheat_AB_2015_Consensus-4B41.3
Wheat_Yr_2021-4B50.88
[ Show Nearby Loci ]
Map Data
Wheat, Yr Update, 2021
Wheat_AB, Colosseo x Lloyd
Wheat_AB, Latino x MG5323
Wheat_AB, Meridiano x Claudio
Wheat_AB_2015_Consensus
Probe
BARC20
Possible Orthologs
Xbarc20
Xbarc20-4B
Xbarc20-7B
barc20
barc20-7B



Locus for Probe
Xbarc20
Type
Microsatellite
Chromosome
7B
Map
Ta-NxW-4B31.5
Wheat, Avalon x Cadenza 4B112.5
Wheat, UC1110 x PI610750 4B35.3
Wheat-Composite2004-7B115
[ Show Nearby Loci ]
Map Data
Wheat, Avalon x Cadenza
Wheat, Composite, 2004
Wheat, Nanda2419 x Wangshuibai
Wheat, UC1110 x PI610750
Probe
BARC20
Reference
ReferenceLowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157.
Possible Orthologs
Xbarc20-4B
Xbarc20-7B
barc20
barc20-4B
barc20-7B



Locus for Probe
Xbarc20-4B
Type
Microsatellite
Chromosome
4B
Map
Chinese_Spring_Deletion_SSR_4B-0.69
Ta-SSR-2004-4B21.6
[ Show Nearby Loci ]
Breakpoint Interval
4BS8-0.57-0.81
Map Data
Wheat, Consensus SSR, 2004
Wheat, Physical, SSR
Probe
BARC20
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
Possible Orthologs
Xbarc20
Xbarc20-7B
barc20
barc20-4B
barc20-7B



Locus for Probe
Xbarc20-7B
Type
Microsatellite
Chromosome
7B
Map
Ta-Synthetic/Opata-BARC-7B133.2
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata, BARC
Probe
BARC20
Possible Orthologs
Xbarc20
Xbarc20-4B
barc20
barc20-4B
barc20-7B



Locus for Probe
barc20-7B
Type
Microsatellite
Chromosome
7B
Map
Wheat_Yr_2021-7B177.72
[ Show Nearby Loci ]
Map Data
Wheat, Yr Update, 2021
Probe
BARC20
Possible Orthologs
Xbarc20
Xbarc20-4B
Xbarc20-7B
barc20
barc20-4B

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.