Query (optional)   in Class  

GrainGenes Marker Report: BARC32

[ Submit comment/correction ]

Probe
BARC32
Locus
Xbarc32-7B
[ Show all 17 ]
Reference
ReferenceRen RS et al. (2012) Characterization and molecular mappingof Yr52 for high-temperature adult-plant resistance to stripe rust in spring wheat germplasm PI 183527 Theoretical and Applied Genetics 125:847-857.
ReferenceMAS Wheat. Bringing Genomics to the Wheat Fields. Disease Resistance. Stripe Rust Resistance. Yr59 MAS Wheat. Marker Assisted Selection in Wheat.
Remarks
Contains motif : (TAA)10
BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type
PCR
SSR
PCR primers
5' GCGTGAATCCGGAAACCCAATCTGTG 3'
5' TGGAGAACCTTCGCATTGTGTCATTA 3'
Amplification Conditions
Annealing temperature = 52
Sequence
BV211664
Source Species
Triticum aestivum
Data Source
Ward, Rick



Locus for Probe
barc32-7B
Type
Microsatellite
In QTL
QKpsm.KoxSv-7B.2
QYld.KoxSv-7B.4
Probe
BARC32
Possible Orthologs
Xbarc32
[ Show all 15 ]



Locus for Probe
Yr59
Chromosome
7B
Chromosome Arm
7BL
Map
Wheat, Yr genes and QTL 7B80.9
[ Show Nearby Loci ]
Map Data
Wheat, Yr genes and QTL
Probe
BARC32
WGP5175
WMC557
Associated Gene
Yr59 (Triticum)
Gene Class
Reaction to Puccinia striiformis Westend.
Reference
ReferenceRen RS et al. (2012) Characterization and molecular mappingof Yr52 for high-temperature adult-plant resistance to stripe rust in spring wheat germplasm PI 183527 Theoretical and Applied Genetics 125:847-857.
ReferenceMAS Wheat. Bringing Genomics to the Wheat Fields. Disease Resistance. Stripe Rust Resistance. Yr59 MAS Wheat. Marker Assisted Selection in Wheat.



Locus for Probe
barc32
Type
Microsatellite
Map
Wheat, Yr genes and QTL 5B11.9
Wheat, Yr genes and QTL 7B80.5
Wheat_2017_LRC-7B52.2
[ Show Nearby Loci ]
Map Data
Wheat, Yr genes and QTL
Wheat_2017_LRC
Probe
BARC32
Possible Orthologs
Xbarc32
[ Show all 15 ]



Locus for Probe
barc32a-7B
Type
Microsatellite
Map
Wheat_AB, Kofa x Svevo 7B167
Wheat_AB_2015_Consensus-7B188
[ Show Nearby Loci ]
Map Data
Wheat_AB, Kofa x Svevo
Wheat_AB_2015_Consensus
Probe
BARC32
Possible Orthologs
Xbarc32
[ Show all 15 ]



Locus for Probe
barc32b-7B
Type
Microsatellite
Map
Wheat_AB, Latino x MG5323 7B156.6
Wheat_AB_2015_Consensus-7B189.7
[ Show Nearby Loci ]
Map Data
Wheat_AB, Latino x MG5323
Wheat_AB_2015_Consensus
Probe
BARC32
Possible Orthologs
Xbarc32
[ Show all 15 ]



Locus for Probe
barc32c-7B
Type
Microsatellite
Map
Wheat_AB, Simeto x Levante 7B229.22
Wheat_AB_2015_Consensus-7B194.1
[ Show Nearby Loci ]
Map Data
Wheat_AB, Simeto x Levante
Wheat_AB_2015_Consensus
Probe
BARC32
Possible Orthologs
Xbarc32
[ Show all 15 ]



Locus for Probe
barc32a
Type
Microsatellite
Map
Wheat, Yr genes and QTL 7B79.7
[ Show Nearby Loci ]
Map Data
Wheat, Yr genes and QTL
Probe
BARC32
Possible Orthologs
Xbarc32
[ Show all 15 ]



Locus for Probe
barc32b
Type
microsatellite
Map
Wheat, Yr genes and QTL 7B80.9
Wheat_AB_2017_Carotenoid_QTL-7B189.7
[ Show Nearby Loci ]
Map Data
Wheat AB, Carotenoid QTL, 2017
Wheat, Yr genes and QTL
Probe
BARC32
Possible Orthologs
Xbarc32
[ Show all 15 ]



Locus for Probe
barc32c
Type
Microsatellite
Map
Wheat, Yr genes and QTL 7B83.2
[ Show Nearby Loci ]
Map Data
Wheat, Yr genes and QTL
Probe
BARC32
Possible Orthologs
Xbarc32
[ Show all 15 ]



Locus for Probe
Xbarc32
Type
Microsatellite
Chromosome
5B
Map
Ta-NxW-7B192.2
Wheat, Avalon x Cadenza 7B67.4
Wheat-Composite2004-5B33
[ Show Nearby Loci ]
Map Data
Wheat, Avalon x Cadenza
Wheat, Composite, 2004
Wheat, Nanda2419 x Wangshuibai
Probe
BARC32
Possible Orthologs
Xbarc32-5B
[ Show all 15 ]



Locus for Probe
Xbarc32-5B
Type
Microsatellite
Chromosome
5B
Map
Chinese_Spring_Deletion_SSR_5B0.895
Ta-Synthetic/Opata-BARC-5B14.4
[ Show Nearby Loci ]
Breakpoint Interval
5BL16-0.79-1.00
Map Data
Wheat, Physical, SSR
Wheat, Synthetic x Opata, BARC
Probe
BARC32
Possible Orthologs
Xbarc32
[ Show all 15 ]



Locus for Probe
Xbarc32-7B
Type
Microsatellite
Chromosome
7B
Map
AUS14010xYallaroi-7BL0
Chinese_Spring_Deletion_SSR_7B0.5
CranbrookxHalberd-7BL0
CS/SQ1-7B199.1
Ta-SSR-2004-7B142
[ Show Nearby Loci ]
In QTL
QYld.saq-7B
Breakpoint Interval
C-7BL-0.00-1.00*
Map Data
Wheat, 2008, B Tolerance
Wheat, Chinese Spring x SQ1
Wheat, Consensus SSR, 2004
Wheat, Physical, SSR
Probe
BARC32
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
Possible Orthologs
Xbarc32
[ Show all 15 ]



Locus for Probe
barc32-5B
Type
Microsatellite
Chromosome
5B
Probe
BARC32
Possible Orthologs
Xbarc32
[ Show all 15 ]



Locus for Probe
barc32-7B.1
Type
Microsatellite
Chromosome
7B
Probe
BARC32
Remark
barc32 has many versions and letter extensions in GrainGenes. barc32-7B.1, barc32-7B.2, barc32-7B.3, and barc32-7B.4 were renamed for position on the 7B map in GGG-5-449
Possible Orthologs
Xbarc32
[ Show all 15 ]



Locus for Probe
barc32-7B.2
Type
Microsatellite
Chromosome
7B
Probe
BARC32
Remark
barc32 has many versions and letter extensions in GrainGenes. barc32-7B.1, barc32-7B.2, barc32-7B.3, and barc32-7B.4 were renamed for position on the 7B map in GGG-5-449
Possible Orthologs
Xbarc32
[ Show all 15 ]



Locus for Probe
barc32-7B.3
Type
Microsatellite
Chromosome
7B
Probe
BARC32
Remark
barc32 has many versions and letter extensions in GrainGenes. barc32-7B.1, barc32-7B.2, barc32-7B.3, and barc32-7B.4 were renamed for position on the 7B map in GGG-5-449
Possible Orthologs
Xbarc32
[ Show all 15 ]



Locus for Probe
barc32-7B.4
Type
Microsatellite
Chromosome
7B
Probe
BARC32
Remark
barc32 has many versions and letter extensions in GrainGenes. barc32-7B.1, barc32-7B.2, barc32-7B.3, and barc32-7B.4 were renamed for position on the 7B map in GGG-5-449
Possible Orthologs
Xbarc32
[ Show all 15 ]

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.