Query (optional)   in Class  

GrainGenes Marker Report: BARC69

[Submit comment/correction]

Probe
BARC69
Locus
Xbarc69-5B
[ Show all 9 ]
Remarks
Contains motif : (TATC)15
BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type
PCR
SSR
PCR primers
5' AGGCGGCGGTCGTGGAACA 3'
5' GCGTACCGAGAAGTGATCAAGAACAT 3'
Amplification Conditions
Annealing temperature = 55
Sequence
BV211794
Source Species
Triticum aestivum
Data Source
Ward, Rick



Locus for Probe
barc69
Type
microsatellite
Map
Durum Wheat, NSGC Lr 3A129.5
[ Show all 6 ]
[ Show Nearby Loci ]
Map Data
Durum Wheat, NSGC Lr
Wheat AB, Carotenoid QTL, 2017
Wheat, Yr genes and QTL
Probe
BARC69
Possible Orthologs
Barc069
[ Show all 8 ]



Locus for Probe
barc69-3A
Type
Microsatellite
Map
Wheat_AB, Colosseo x Lloyd 3A_276.6
Wheat_AB_2015_Consensus-3A129.5
Wheat_Yr_2021-3A139.58
[ Show Nearby Loci ]
Map Data
Wheat, Yr Update, 2021
Wheat_AB, Colosseo x Lloyd
Wheat_AB_2015_Consensus
Probe
BARC69
Possible Orthologs
Barc069
[ Show all 8 ]



Locus for Probe
barc69-3B
Type
Microsatellite
Map
Wheat_AB, Latino x MG5323 3B123.1
Wheat_AB_2015_Consensus-3B142.2
Wheat_Yr_2021-3B141.15
[ Show Nearby Loci ]
Map Data
Wheat, Yr Update, 2021
Wheat_AB, Latino x MG5323
Wheat_AB_2015_Consensus
Probe
BARC69
Possible Orthologs
Barc069
[ Show all 8 ]



Locus for Probe
Xbarc69
Type
Microsatellite
Chromosome
5B
Map
Wheat-Composite2004-5B130
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Probe
BARC69
Possible Orthologs
Barc069
[ Show all 8 ]



Locus for Probe
Xbarc69-3A
Type
Microsatellite
Chromosome
3A
Map
Ta-SSR-2004-3A72.9
[ Show Nearby Loci ]
Map Data
Wheat, Consensus SSR, 2004
Probe
BARC69
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
Possible Orthologs
Barc069
[ Show all 8 ]



Locus for Probe
Xbarc69-5A
Type
Microsatellite
Map Data
Wheat, Consensus SSR, 2004
Probe
BARC69
Possible Orthologs
Barc069
[ Show all 8 ]



Locus for Probe
Xbarc69-5B
Type
Microsatellite
Chromosome
5B
Map
Chinese_Spring_Deletion_SSR_5B0.775
Ta-Synthetic/Opata-BARC-5B120.4
[ Show Nearby Loci ]
Breakpoint Interval
5BL9-0.76-0.79
Map Data
Wheat, Physical, SSR
Wheat, Synthetic x Opata, BARC
Probe
BARC69
Possible Orthologs
Barc069
[ Show all 8 ]



Locus for Probe
Barc069
Type
Microsatellite
Chromosome
3H
Map
Hordeum-Zhedar2-FHB-QTL-3H144.4
[ Show Nearby Loci ]
In QTL
QHD.dah-3H
Map Data
Barley, Zhedar2, FHB QTL
Probe
BARC69
Possible Orthologs
Xbarc69
[ Show all 8 ]



Locus for Probe
barc69-5B
Type
Microsatellite
Chromosome
5B
Map
Wheat_Yr_2021-5B198.95
[ Show Nearby Loci ]
Map Data
Wheat, Yr Update, 2021
Probe
BARC69
Possible Orthologs
Barc069
[ Show all 8 ]

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.