Query (optional)   in Class  

GrainGenes Marker Report: Bmac0031

[ Printable Version ]  [ Submit comment/correction ]

Locus
Bmac0031
Type
Microsatellite
Synonym
SynonymBmac31
Chromosome
7H
Map
Barley, B73xCPI-7H87
[ Show all 9 ]
[ Show Nearby Loci ]
Map Data
Barley, Abiotic QTL Consensus
[ Show all 9 ]
Species
Hordeum vulgare
Probe
Bmac0031
Bmac31
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
ReferenceRamsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
[ Show all 7 ]
Possible Orthologs
Bmac31
Bmac31a
Bmac31b



Probe for Locus
Bmac31
Locus
Bmac0031
Bmac31
Bmac31a
Bmac31b
Synonym
Other nameBmac0031
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceRamsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks
Insert contains repeat (AC)28
Quality = 2: Single product, relatively strong stutter bands
Diversity Index (DI) = 0.37
Type
PCR
SSR
PCR primers
5' AGAGAAAGAGAAATGTCACCA 3'
5' ATACATCCATGTGAGGGC 3'
AGAGAAAGAGAAATGTCACCA
ATACATCCATGTGAGGGC
SSR size
175
Amplification Conditions
1 cycle of 3 mins @ 94C, 1 min @ 66C, 1 min @ 72C, 5 cycles of 30 secs @ 94C, 30 secs @ 65C (decreasing 1C per cycle), 30 secs @ 72C, 24 cycles of 30 secs @ 94C, 30 secs @ 60C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C.
Source Species
Hordeum vulgare



Probe
Bmac0031
Locus
Bmac0031
Synonym
Other nameBmac31
Reference
ReferenceHayden MJ et al. (2008) Multiplex-Ready PCR: A new method for multiplexed SSR and SNP genotyping BMC Genomics 9:80.
ReferenceHearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391.
Type
SSR
PCR primers
AGAGAAAGAGAAATGTCACCA
ATACATCCATGTGAGGGC
Forward AGAGAAAGAGAAATGTCACCA
Reverse ATACATCCATGTGAGGGC