Query (optional)   in Class  

GrainGenes Marker Report: Bmac0144l

[ Printable Version ]  [ Submit comment/correction ]

Locus
Bmac0144l
Type
Microsatellite
Chromosome
5H
Map
Hordeum-Consensus2007-SSR-5H84.78
Hv-Consensus2006-Marcel-5H84.78
Hv-Integrated2009-5H82.4
[ Show Nearby Loci ]
Map Data
Barley, Consensus 2006, Marcel
Barley, Consensus 2007, SSR
Barley, Integrated, Marcel 2009
Species
Hordeum vulgare
Probe
Bmac0144
Bmac144
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceRamsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
[ Show all 6 ]
Possible Orthologs
Bmac0144
[ Show all 13 ]



Probe for Locus
Bmac0144
Locus
Bmac0144
[ Show all 13 ]
Synonym
Other nameBmac144
Reference
ReferenceHearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391.
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceRamsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Type
SSR
PCR primers
TACGTGTACATACTCTACGATTTG
ACTTATTCTGCATCCTGGGT



Probe for Locus
Bmac144
Locus
Bmac0144a
[ Show all 13 ]
Synonym
Other nameBmac0144
Reference
ReferenceRamsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks
Insert contains repeat (AT)4(AC)20
Quality = 3: Strong major polymorphic product, with additional strong bands. Multi-locus or weak but scoreable products
Type
PCR
SSR
PCR primers
5' TACGTGTACATACTCTACGATTTG 3'
5' ACTTATTCTGCATCCTGGGT 3'
SSR size
179
Amplification Conditions
1 cycle of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 30 cycles of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 1 cycle of 5 mins @ 72C.
Source Species
Hordeum vulgare