Query (optional)   in Class  

GrainGenes Marker Report: Bmac0213

[Submit comment/correction]

Locus
Bmac0213
Type
Microsatellite
Synonym
SynonymBmac213
Chromosome
1H
Map
Barley, B73xCPI-1H21.3
[ Show all 12 ]
[ Show Nearby Loci ]
QTL with Locus Marker
QHea.pil-1H.2
Map Data
Barley, Abiotic QTL Consensus
[ Show all 12 ]
Species
Hordeum spontaneum
Hordeum vulgare
Probe
Bmac0213
Bmac213
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
ReferenceMesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318.
ReferenceRamsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
[ Show all 6 ]
Possible Orthologs
Bmac213



Probe for Locus
Bmac213
Locus
Bmac0213
Bmac213
Synonym
Other nameBmac0213
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceRamsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks
Insert contains repeat (AC)23
Quality = 2: Single product, relatively strong stutter bands
Type
PCR
SSR
PCR primers
5' ATGGATGCAAGACCAAAC 3'
5' CTATGAGAGGTAGAGCAGCC 3'
ATGGATGCAAGACCAAAC
CTATGAGAGGTAGAGCAGCC
SSR size
168
Amplification Conditions
1 cycle of 3 min @ 94C, 1 min @ 58C, 1 min @ 72C, 30 cycles of 30 secs @ 94C, 30 secs @ 58C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C.
Source Species
Hordeum vulgare



Probe
Bmac0213
Locus
Bmac0213
Synonym
Other nameBmac213
Reference
ReferenceHearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391.
Type
SSR
PCR primers
ATGGATGCAAGACCAAAC
CTATGAGAGGTAGAGCAGCC

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.