Query (optional)   in Class  

GrainGenes Marker Report: Bmac163

[ Printable Version ]  [ Submit comment/correction ]

Locus
Bmac163
Type
Microsatellite
Synonym
SynonymBmac0163
Chromosome
5H
Map
Hordeum-Consensus2006-DArT-5H48.8
[ Show Nearby Loci ]
Map Data
Barley, Consensus 2006, DArT
Barley, Steptoe x Morex, SSR
Probe
Bmac163
Reference
ReferenceWenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
Remark
Number of populations contributing to the placement of Bmac163 in the Barley, Consensus 2006 DArT maps = 1
Possible Orthologs
Bmac0163



Probe
Bmac163
Locus
Bmac0163
Bmac163
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceRamsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remarks
Insert contains repeat (AC)6(GC)3(AC)17
Quality = 1: Single product, only weak stutter bands
Diversity Index (DI) = 0.49
Type
PCR
SSR
PCR primers
5' TTTCCAACAGAGGGTATTTACG 3'
5' GCAAAGCCCATGATACATACA 3'
TTTCCAACAGAGGGTATTTACG
GCAAAGCCCATGATACATACA
SSR size
146
Amplification Conditions
1 cycle of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 30 cycles of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 1 cycle of 5 mins @ 72C.
Source Species
Hordeum vulgare



Locus for Probe
Bmac0163
Type
Microsatellite
Synonym
SynonymBmac163
Chromosome
5H
Map
Hordeum-Consensus2005-SNP-5H28.189
[ Show all 9 ]
[ Show Nearby Loci ]
Map Data
Barley, Abiotic QTL Consensus
[ Show all 9 ]
Species
Hordeum spontaneum
Hordeum vulgare
Probe
Bmac163
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
ReferenceMesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318.
ReferenceRamsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
[ Show all 7 ]
Possible Orthologs
Bmac163