Query (optional)   in Class  

GrainGenes Marker Report: Bmag0113f

[ Printable Version ]  [ Submit comment/correction ]

Locus
Bmag0113f
Type
Microsatellite
Chromosome
5H
Map
Hordeum-Consensus2007-SSR-5H84.78
Hv-Integrated2009-5H82.4
Hv-Nure/Tremois-5H70.8
[ Show Nearby Loci ]
Map Data
Barley, Consensus 2007, SSR
Barley, Integrated, Marcel 2009
Barley, Nure x Tremois
Species
Hordeum vulgare
Probe
Bmag0113
Bmag113
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceRamsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Oregon Wolfe Barleys,Nure x Tremois
Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : OWBrecessive x OWBdominant
Insert contains repeat (AG)18
Developing laboratory = SCRI (R. Waugh)
Possible Orthologs
Bmag0113
[ Show all 16 ]



Probe for Locus
Bmag0113
Locus
Bmag0113c
[ Show all 9 ]
Synonym
Other nameBmag113
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceRamsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Type
SSR
PCR primers
GGAATCTTCTGGAACGTC
TTAAGAAGATCATTGTATTGAAGA



Probe for Locus
Bmag113
Locus
Bmag0113c
[ Show all 17 ]
Synonym
Other nameBmag0113
Reference
ReferenceRamsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks
Insert contains repeat (AG)18
Quality = 3: Strong major polymorphic product, with additional strong bands. Multi-locus or weak but scoreable products
Type
PCR
SSR
PCR primers
5' GGAATCTTCTGGAACGTC 3'
5' TTAAGAAGATCATTGTATTGAAGA 3'
SSR size
153
Amplification Conditions
1 cycle of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 30 cycles of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 1 cycle of 5 mins @ 72C.
Source Species
Hordeum vulgare