Query (optional)   in Class  

GrainGenes Marker Report: Bmag0122

[ Printable Version ]  [ Submit comment/correction ]

Locus
Bmag0122
Type
Microsatellite
Synonym
SynonymBmag122
Chromosome
3H
Map
Hordeum-Consensus2005-SNP-3H46.4
[ Show all 7 ]
[ Show Nearby Loci ]
Map Data
Barley, Abiotic QTL Consensus
[ Show all 7 ]
Species
Hordeum spontaneum
Hordeum vulgare
Probe
Bmag0122
Bmag122
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
ReferenceMesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318.
ReferenceRamsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark
Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Lina x H. spontaneum
Insert contains repeat (AG)16
Developing laboratory = SCRI (R. Waugh)
Possible Orthologs
Bmag122



Probe for Locus
Bmag122
Locus
Bmag0122
Bmag122
Synonym
Other nameBmag0122
Reference
ReferenceRamsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks
Insert contains repeat (AG)16
Quality = 4: Ladders of bands that are at equal intensity, but may contain scoreable weak products
Type
PCR
SSR
PCR primers
5' AGGGAGGATTAATCACGG 3'
5' AAGATGTGATGATCATTGTATTG 3'
SSR size
178
Amplification Conditions
1 cycle of 3 min @ 94C, 1 min @ 58C, 1 min @ 72C, 30 cycles of 30 secs @ 94C, 30 secs @ 58C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C.
Source Species
Hordeum vulgare



Probe
Bmag0122
Locus
Bmag0122
Synonym
Other nameBmag122
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceRamsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Type
SSR
PCR primers
AGGGAGGATTAATCACGG
AAGATGTGATGATCATTGTATTG