Query (optional)   in Class  

GrainGenes Marker Report: Bmag0507

[ Printable Version ]  [ Submit comment/correction ]

Locus
Bmag0507
Type
Microsatellite
Chromosome
7H
Map
Barley, B73xCPI-7H89.7
Hordeum-Consensus2007-SSR-7H84.1
Hordeum-LxHs-7H111
Hv-Integrated2009-7H83.1
Hv-L94/Vada-2006-7H82.59
[ Show Nearby Loci ]
Map Data
Barley, B73xCPI
Barley, Consensus 2007, SSR
Barley, Integrated, Marcel 2009
Barley, L94 x Vada, 2006
Barley, LxHs
Species
Hordeum spontaneum
Hordeum vulgare
Probe
Bmag0507
Bmag507
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceRamsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
[ Show all 6 ]



Probe for Locus
Bmag507
Locus
Bmag0507
Bmag507
Bmag507-7H
Synonym
Other nameBmag0507
Reference
ReferenceRamsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks
Insert contains repeat (AG)23
Quality = 1: Single product, only weak stutter bands
Diversity Index (DI) = 0.69
Type
PCR
SSR
PCR primers
5' CAACTAGCATACCCAAGCTATA 3'
5' ACCCCTATTTCAATAATGGA 3'
SSR size
147
Amplification Conditions
1 cycle of 3 min @ 94C, 1 min @ 58C, 1 min @ 72C, 30 cycles of 30 secs @ 94C, 30 secs @ 58C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C.
Source Species
Hordeum vulgare



Probe
Bmag0507
Locus
Bmag0507
Synonym
Other nameBmag507
Reference
ReferenceHayden MJ et al. (2008) Multiplex-Ready PCR: A new method for multiplexed SSR and SNP genotyping BMC Genomics 9:80.
ReferenceHearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391.
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceRamsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Type
SSR
PCR primers
CAACTAGCATACCCAAGCTATA
ACCCCTATTTCAATAATGGA
Forward CAACTAGCATACCCAAGCTATA
Reverse ACCCCTATTTCAATAATGGA