Query (optional)   in Class  

GrainGenes Marker Report: Bmag0794

[ Printable Version ]  [ Submit comment/correction ]

Locus
Bmag0794
Type
Microsatellite
Chromosome
7H
Map
Hordeum-Consensus2005-SNP-7H28.391
Hordeum-LiHs-SNP-7H18.57
Hordeum-QTLConsensus-Abiotic-7H28.39
Hordeum-QTLConsensus-Agronomic-7H28.39
[ Show Nearby Loci ]
Map Data
Barley, Abiotic QTL Consensus
Barley, Agronomic QTL Consensus
Barley, Consensus 2005, SNP
Barley, Lina x H.spont, SNP
Probe
Bmag794
Reference
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Possible Orthologs
EBmag0794



Probe for Locus
Bmag794
Locus
Bmag0794



Probe
Bmag0794
Locus
EBmag0794
Synonym
See alsoEBmag0794
EBmag794
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceRamsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Type
SSR
PCR primers
CAGTCATAACCTGATGAACAA
TCACACTTATCTTGCTGCTAA



Locus for Probe
EBmag0794
Type
Microsatellite
Chromosome
7H
Map
Barley, B73xCPI-7H19.2
Hordeum-Consensus2007-SSR-7H15.79
Hordeum-LxHs-7H18
[ Show Nearby Loci ]
Map Data
Barley, B73xCPI
Barley, Consensus 2007, SSR
Barley, LxHs
Species
Hordeum spontaneum
Hordeum vulgare
Probe
Bmag0794
EBmag0794
EBmag794
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceRamsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark
Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Lina x H. spontaneum
Insert contains repeat (TA)23,(GA)16
Polymorphic Information Content (PIC) = 0.84
Developing laboratory = SCRI (R. Waugh)
Possible Orthologs
Bmag0794