Query (optional)   in Class  

GrainGenes Marker Report: Bmag138b

[ Printable Version ]  [ Submit comment/correction ]

Locus
Bmag138b
Type
Microsatellite
Chromosome
4H
Map
Hordeum-FxS-FHB-QTL-4H236.3
Hv-Consensus2006-Marcel-4H124
[ Show Nearby Loci ]
Map Data
Barley, Consensus 2006, Marcel
Barley, FxS, FHB QTL
Probe
Bmag138
Reference
ReferenceMesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318.
Remark
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs
Bmag0138
[ Show all 8 ]



Probe for Locus
Bmag138
Locus
Bmag0138a
[ Show all 6 ]
Reference
ReferenceRamsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks
Insert contains repeat (AG)6(AG)15
Quality = 2: Single product, relatively strong stutter bands
Diversity Index (DI) = 0.62
Type
PCR
SSR
PCR primers
5' ACCAGGAGGAATGAGAGAG 3'
5' AATAAACCTTGAGACGATGG 3'
SSR size
169
Amplification Conditions
1 cycle of 3 min @ 94C, 1 min @ 58C, 1 min @ 72C, 30 cycles of 30 secs @ 94C, 30 secs @ 58C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C.
Source Species
Hordeum vulgare