Query (optional)   in Class  

GrainGenes Marker Report: Bmag382

[ Printable Version ]  [ Submit comment/correction ]

Locus
Bmag382
Type
Microsatellite
Chromosome
1H
Map
Hordeum-Consensus2006-DArT-1H100.2
Hordeum-IxF-SSR-1H81.4
Hordeum-Zhedar2-FHB-QTL-1H133.7
Hv-Consensus2006-Marcel-1H99.69
[ Show Nearby Loci ]
QTL with Locus Marker
QFhs.dah-1H.2
Map Data
Barley, Consensus 2006, DArT
Barley, Consensus 2006, Marcel
Barley, Igri x Franka, SSR
Barley, Zhedar2, FHB QTL
Probe
Bmag382
Reference
ReferenceWenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
ReferenceLi JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Remark
Number of populations contributing to the placement of Bmag382 in the Barley, Consensus 2006 DArT maps = 1
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs
Bmag0382



Probe
Bmag382
Locus
Bmag0382
Bmag382
Synonym
Other nameBmag0382
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceRamsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remarks
Insert contains repeat (AG)7AA(AG)7
Quality = 2: Single product, relatively strong stutter bands
Diversity Index (DI) = 0.36
Type
PCR
SSR
PCR primers
5' TGAAACCCATAGAGAGTGAGA 3'
5' TCAAAAGTTTCGTTCCAAATA 3'
TGAAACCCATAGAGAGTGAGA
TCAAAAGTTTCGTTCCAAATA
SSR size
109
Amplification Conditions
1 cycle of 3 min @ 94C, 1 min @ 58C, 1 min @ 72C, 30 cycles of 30 secs @ 94C, 30 secs @ 58C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C.
Source Species
Hordeum vulgare



Locus for Probe
Bmag0382
Type
Microsatellite
Chromosome
1H
Map
Barley, B73xCPI-1H85.9
Hordeum-Consensus2007-SSR-1H99.69
Hordeum-LxHs-1H97
Hv-Integrated2009-1H102.9
Hv-Nure/Tremois-1H80.1
[ Show Nearby Loci ]
Map Data
Barley, B73xCPI
Barley, Consensus 2007, SSR
Barley, Integrated, Marcel 2009
Barley, LxHs
Barley, Nure x Tremois
Species
Hordeum vulgare
Probe
Bmag0382
Bmag382
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceRamsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
[ Show all 6 ]
Possible Orthologs
Bmag382