Query (optional)   in Class  

GrainGenes Marker Report: CFA2019

[Submit comment/correction]

Probe
CFA2019
Locus
Xcfa2019-7A
Sr22
cfa2019
Xcfa2019
Reference
ReferenceSourdille P et al. (2001) Improvement of the genetic maps of wheat using new microsatellite markers Plant & Animal Genome IX Abstracts 167.
Remarks
Quality Score = B
Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems)
Amplifies motif: (CA)14
Regularity of motif is perfect
Type
PCR
SSR
PCR primers
Forward 5' GACGAGCTAACTGCAGACCC 3'
Reverse 5' CTCAATCCTGATGCGGAGAT 3'
SSR size
217
Amplification Conditions
5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group
7A
Source Species
Triticum urartu
Data Source
Sourdille, Pierre



Locus for Probe
cfa2019
Type
Microsatellite
Map
Wheat, Yr genes and QTL 7A93.6
Wheat-2014-Consensus-Ug99-Update_7A111.37
Wheat_Consensus_2014_Ug99_Rust_7A111.37
Wheat_Yr_2021-7A232.66
[ Show Nearby Loci ]
Map Data
Wheat, Yr genes and QTL
Wheat, Yr Update, 2021
Wheat-2014-Consensus-Ug99-Update
Wheat_Consensus_2014_Ug99_Rust
Probe
CFA2019
Possible Orthologs
Xcfa2019-7A
Xcfa2019



Locus for Probe
Xcfa2019
Type
Microsatellite
Map
Wheat, WH542 x Synthetic 7A14.8
[ Show Nearby Loci ]
Map Data
Wheat, WH542 x Synthetic
Probe
CFA2019
Possible Orthologs
Xcfa2019-7A
cfa2019



Locus for Probe
Sr22
Type
Gene
Trait
Chromosome
7A
Chromosome Arm
7AL
Map
Triticum-Genes-7A29.4
Wheat-2014-Consensus-Ug99-Update_7A112
Wheat-Composite2004-7A171
[ Show Nearby Loci ]
Map Data
Wheat genes
Wheat-2014-Consensus-Ug99-Update
2 Point Data
Centromere/Sr22#1
[ Show all 7 ]
Species
Triticum aestivum
Probe
BARC121
CFA2019
CFA2123
WMC633
Associated Gene
Sr22 (Triticum)
Gene Class
Reaction to Puccinia graminis Pers.
Reference
ReferenceYu L et al. (2014) A consensus map for Ug99 stem rust resistance loci in wheat. Theoretical and Applied Genetics 127:1561-1581.
ReferenceKhan RR et al. (2005) Molecular mapping of stem and leaf rust resistance in wheat Theoretical and Applied Genetics 111:846-850.
ReferenceThe TT (1973) Chromosome location of genes conditioning stem rust resistance transferred from diploid to hexaploid wheat. Nature New Biology 241:256.
ReferenceBrown-Guedira G et al. MAS Wheat. Bringing Genomics to the Wheat Fields. Disease resistance. Stem Rust Resistance. Sr22 MAS Wheat. Marker Assisted Selection in Wheat.
Data Source
Matthews, David E.
Remark
Trait marker Xcfa2019-7A
Nearby marker on Composite map: Xgwm282
Position on Composite map estimated by GrainGenes.
The location on the 2014 Ug99 Consensus Map is approximate.



Locus for Probe
Xcfa2019-7A
Type
Microsatellite
Chromosome
7A
Map
Chinese_Spring_Deletion_SSR_7A0.88
T.b.xT.m.-7A253.9
Ta-Courtot/CS-GPW-7A224
Ta-SSR-2004-7A106.6
[ Show Nearby Loci ]
Breakpoint Interval
7AL16-0.86-0.90
Map Data
T. boeoticum x monococcum
Wheat, Consensus SSR, 2004
Wheat, Courtot x Chinese Spring, GPW
Wheat, Physical, SSR
Probe
CFA2019
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
Possible Orthologs
cfa2019
Xcfa2019

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.