Query (optional)   in Class  

GrainGenes Marker Report: CFA2076

[ Submit comment/correction ]

Probe
CFA2076
Locus
Xcfa2076-3A
[ Show all 6 ]
Reference
ReferenceSourdille P et al. (2001) Improvement of the genetic maps of wheat using new microsatellite markers Plant & Animal Genome IX Abstracts 167.
Remarks
Quality Score = B
Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems)
Amplifies motif: (TG)18
Regularity of motif is imperfect
Type
PCR
SSR
PCR primers
Forward 5' CGAAAAACCATGATCGACAG 3'
Reverse 5' ACCTGTCCAGCTAGCCTCCA 3'
SSR size
172
Amplification Conditions
5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group
3D
Source Species
Triticum urartu
Data Source
Sourdille, Pierre



Locus for Probe
cfa2076-3A
Type
Microsatellite
Map
KPxKC-3A143.3
Wheat_AB, Meridiano x Claudio 3A_317.9
Wheat_AB_2015_Consensus-3A162.5
[ Show Nearby Loci ]
Map Data
Wheat, Klein Proteo x Klein Chaja
Wheat_AB, Meridiano x Claudio
Wheat_AB_2015_Consensus
Probe
CFA2076
Possible Orthologs
Xcfa2076-3A
Xcfa2076-5A
cfa2076



Locus for Probe
cfa2076
Type
Microsatellite
Map
Durum Wheat, NSGC Lr 3A162.5
Wheat, Yr genes and QTL 3A75.8
Wheat-2014-Consensus-Ug99-Update_3A29.75
Wheat_Consensus_2014_Ug99_Rust_3A29.75
[ Show Nearby Loci ]
Map Data
Durum Wheat, NSGC Lr
Wheat, Yr genes and QTL
Wheat-2014-Consensus-Ug99-Update
Wheat_Consensus_2014_Ug99_Rust
Probe
CFA2076
Possible Orthologs
Xcfa2076-3A
Xcfa2076-5A
cfa2076-3A



Locus for Probe
Sr35
Type
Gene
Chromosome
3A
Chromosome Arm
3AL
Map
Triticum-Genes-3A40
Wheat-2014-Consensus-Ug99-Update_3A114
[ Show Nearby Loci ]
Map Data
Wheat genes
Wheat-2014-Consensus-Ug99-Update
2 Point Data
Centromere/Sr35#1
Sr35/R2#1
Probe
AK335187
[ Show all 9 ]
Associated Gene
Sr35 (Triticum)
Gene Class
Reaction to Puccinia graminis Pers.
Reference
ReferenceYu L et al. (2014) A consensus map for Ug99 stem rust resistance loci in wheat. Theoretical and Applied Genetics 127:1561-1581.
ReferenceSaintenac C et al. (2013) Identification of Wheat Gene Sr35 That Confers Resistance to Ug99 Stem Rust Race Group Science 341:783-786.
ReferenceZhang W et al. (2010) Genetic Maps of Stem Rust Resistance Gene Sr35 in Diploid and Hexaploid Wheat Crop Science 50:2464-2474.
ReferenceMcIntosh RA et al. (1984) Cytogenetical studies in wheat. XIII. Sr35 - a third gene from Triticum monococcum for resistance to Puccinia graminis tritici. Zeitschrift fur Pflanzenzuchtung 92:1-14.
ReferenceZhang W et al. MAS Wheat. Bringing Genomics to the Wheat Fields. Disease resistance. Stem Rust Resistance. Sr35 MAS Wheat. Marker Assisted Selection in Wheat.
Remark
The location on the 2014 Ug99 Consensus Map is approximate.



Locus for Probe
tin3
Type
Trait
Chromosome
3A
Map
Wheat-Composite2004-3A61
[ Show Nearby Loci ]
Species
Triticum aestivum
Probe
CFA2076
Associated Gene
tin3 (Triticum)
Gene Class
Tiller inhibition
Reference
ReferenceKuraparthy V et al. (2007) Identification and mapping of a tiller inhibition gene (tin3) in wheat. Theoretical and Applied Genetics 114:265-294.
Remark
Trait marker Xcfa2076-3A
Nearby marker on Composite map: Xwmc169
Position on Composite map estimated by GrainGenes.



Locus for Probe
Xcfa2076-3A
Type
Microsatellite
Chromosome
3A
Map
Ta-Courtot/CS-GPW-3A204.7
Ta-SSR-2004-3A97.7
[ Show Nearby Loci ]
Map Data
Wheat, Consensus SSR, 2004
Wheat, Courtot x Chinese Spring, GPW
Probe
CFA2076
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
Possible Orthologs
Xcfa2076-5A
cfa2076-3A
cfa2076



Locus for Probe
Xcfa2076-5A
Type
Microsatellite
Map Data
Wheat, Consensus SSR, 2004
Probe
CFA2076
Possible Orthologs
Xcfa2076-3A
cfa2076-3A
cfa2076

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.