Query (optional)   in Class  

GrainGenes Marker Report: CFA2123

[Submit comment/correction]

Probe
CFA2123
Locus
Xcfa2123-7A
[ Show all 9 ]
Reference
ReferenceSourdille P et al. (2001) Improvement of the genetic maps of wheat using new microsatellite markers Plant & Animal Genome IX Abstracts 167.
Remarks
Quality Score = A
Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems)
Amplifies motif: (GA)30
Regularity of motif is perfect
Type
PCR
SSR
PCR primers
Forward 5' CGGTCTTTGTTTGCTCTAAACC 3'
Reverse 5' ACCGGCCATCTATGATGAAG 3'
SSR size
259
Amplification Conditions
5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group
7A
Source Species
Triticum urartu
Data Source
Sourdille, Pierre



Locus for Probe
cfa2123
Type
Microsatellite
Map
Durum Wheat, NSGC Lr 7A147.8
Durum Wheat, NSGC Lr 7A154.8
[ Show Nearby Loci ]
Map Data
Durum Wheat, NSGC Lr
Probe
CFA2123
Possible Orthologs
Xcfa2123-7A
[ Show all 7 ]



Locus for Probe
cfa2123a-7A
Type
Microsatellite
Map
Wheat_AB, Kofa x Svevo 7A81.8
Wheat_AB_2015_Consensus-7A147.8
[ Show Nearby Loci ]
Map Data
Wheat_AB, Kofa x Svevo
Wheat_AB_2015_Consensus
Probe
CFA2123
Possible Orthologs
Xcfa2123-7A
[ Show all 7 ]



Locus for Probe
cfa2123b-7A
Type
Microsatellite
Map
Wheat_AB, Meridiano x Claudio 7A_250.9
Wheat_AB_2015_Consensus-7A154.8
[ Show Nearby Loci ]
Map Data
Wheat_AB, Meridiano x Claudio
Wheat_AB_2015_Consensus
Probe
CFA2123
Possible Orthologs
Xcfa2123-7A
[ Show all 7 ]



Locus for Probe
cfa2123a
Type
Microsatellite
Map
Wheat, Yr genes and QTL 7A45.5
[ Show Nearby Loci ]
Map Data
Wheat, Yr genes and QTL
Probe
CFA2123
Possible Orthologs
Xcfa2123-7A
[ Show all 7 ]



Locus for Probe
cfa2123b
Type
Microsatellite
Map
Wheat, Yr genes and QTL 7A49.5
[ Show Nearby Loci ]
Map Data
Wheat, Yr genes and QTL
Probe
CFA2123
Possible Orthologs
Xcfa2123-7A
[ Show all 7 ]



Locus for Probe
Sr22
Type
Gene
Trait
Chromosome
7A
Chromosome Arm
7AL
Map
Triticum-Genes-7A29.4
Wheat-2014-Consensus-Ug99-Update_7A112
Wheat-Composite2004-7A171
[ Show Nearby Loci ]
Map Data
Wheat genes
Wheat-2014-Consensus-Ug99-Update
2 Point Data
Centromere/Sr22#1
[ Show all 7 ]
Species
Triticum aestivum
Probe
BARC121
CFA2019
CFA2123
WMC633
Associated Gene
Sr22 (Triticum)
Gene Class
Reaction to Puccinia graminis Pers.
Reference
ReferenceYu L et al. (2014) A consensus map for Ug99 stem rust resistance loci in wheat. Theoretical and Applied Genetics 127:1561-1581.
ReferenceKhan RR et al. (2005) Molecular mapping of stem and leaf rust resistance in wheat Theoretical and Applied Genetics 111:846-850.
ReferenceThe TT (1973) Chromosome location of genes conditioning stem rust resistance transferred from diploid to hexaploid wheat. Nature New Biology 241:256.
ReferenceBrown-Guedira G et al. MAS Wheat. Bringing Genomics to the Wheat Fields. Disease resistance. Stem Rust Resistance. Sr22 MAS Wheat. Marker Assisted Selection in Wheat.
Data Source
Matthews, David E.
Remark
Trait marker Xcfa2019-7A
Nearby marker on Composite map: Xgwm282
Position on Composite map estimated by GrainGenes.
The location on the 2014 Ug99 Consensus Map is approximate.



Locus for Probe
Xcfa2123-7A
Type
Microsatellite
Map
Chinese_Spring_Deletion_SSR_7A0.55
Ta-Courtot/CS-GPW-7A193.3
[ Show Nearby Loci ]
Breakpoint Interval
7AL1-0.39-0.71
Map Data
Wheat, Courtot x Chinese Spring, GPW
Wheat, Physical, SSR
Probe
CFA2123
Possible Orthologs
cfa2123
[ Show all 7 ]



Locus for Probe
cfa2123-7A.1
Type
Microsatellite
Chromosome
7A
Map
Wheat_Yr_2021-7A113.07
[ Show Nearby Loci ]
Map Data
Wheat, Yr Update, 2021
Probe
CFA2123
Remark
cfa2023 has many versions and letter extensions in GrainGenes. cfa2123-7A.1 and cfa2123-7A.2 were renamed for position on the 7A map in GGG-5-449
Possible Orthologs
Xcfa2123-7A
[ Show all 7 ]



Locus for Probe
cfa2123-7A.2
Type
Microsatellite
Chromosome
7A
Map
Wheat_Yr_2021-7A123.15
[ Show Nearby Loci ]
Map Data
Wheat, Yr Update, 2021
Probe
CFA2123
Remark
cfa2023 has many versions and letter extensions in GrainGenes. cfa2123-7A.1 and cfa2123-7A.2 were renamed for position on the 7A map in GGG-5-449
Possible Orthologs
Xcfa2123-7A
[ Show all 7 ]

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.