Query (optional)   in Class  

GrainGenes Marker Report: CFA2149

[Submit comment/correction]

Probe
CFA2149
Locus
Xcfa2149-4B
Xcfa2149-5A
Yr48
Xcfa2149
Reference
ReferenceLowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157.
ReferenceSourdille P et al. (2001) Improvement of the genetic maps of wheat using new microsatellite markers Plant & Animal Genome IX Abstracts 167.
ReferenceHegarty J et al. MAS Wheat. Bringing Genomics to the Wheat Fields. Disease Resistance. Stripe Rust Resistance. Yr48 MAS Wheat. Marker Assisted Selection in Wheat.
Remarks
Quality Score = B
Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems)
Amplifies motif: (TG)20
Regularity of motif is perfect
Type
PCR
SSR
PCR primers
Forward 5' CTTGGAGCTCGGGTAGTAGC 3'
Reverse 5' AAGGCAGCTCAATCGGAGTA 3'
SSR size
231
Amplification Conditions
5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group
4B
Source Species
Triticum urartu
Data Source
Sourdille, Pierre



Locus for Probe
Yr48
Chromosome
5A
Chromosome Arm
5AL
Map
Wheat, Yr genes and QTL 5A86.8
[ Show Nearby Loci ]
In QTL
Yr48
Map Data
Wheat, Yr genes and QTL
Probe
BE495011
CFA2149
SNF-A2
Linked QTL
Yr48
Associated Gene
Yr48 (Triticum)
Gene Class
Reaction to Puccinia striiformis Westend.
Reference
ReferenceLowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157.
ReferenceHegarty J et al. MAS Wheat. Bringing Genomics to the Wheat Fields. Disease Resistance. Stripe Rust Resistance. Yr48 MAS Wheat. Marker Assisted Selection in Wheat.



Locus for Probe
Xcfa2149
Type
Microsatellite
Map
Wheat, UC1110 x PI610750 5A183.7
[ Show Nearby Loci ]
Map Data
Wheat, UC1110 x PI610750
Probe
CFA2149
Reference
ReferenceLowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157.
Possible Orthologs
Xcfa2149-4B
Xcfa2149-5A



Locus for Probe
Xcfa2149-4B
Type
Microsatellite
Map
Chinese_Spring_Deletion_SSR_4B0.93
Ta-Courtot/CS-GPW-4B94.4
[ Show Nearby Loci ]
Breakpoint Interval
4BL1-0.86-1.00
Map Data
Wheat, Courtot x Chinese Spring, GPW
Wheat, Physical, SSR
Probe
CFA2149
Possible Orthologs
Xcfa2149-5A
Xcfa2149



Locus for Probe
Xcfa2149-5A
Type
Microsatellite
Map
Kofa/UC1113-5A205.9
[ Show Nearby Loci ]
Map Data
Durum wheat, Kofa x UC1113
Probe
CFA2149
Possible Orthologs
Xcfa2149-4B
Xcfa2149

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.