Query (optional)   in Class  

GrainGenes Marker Report: CFA2170

[Submit comment/correction]

Locus
cfa2170
Type
microsatellite
Map
Durum Wheat, NSGC Lr 3A148
[ Show all 6 ]
[ Show Nearby Loci ]
Map Data
3B Physical
Durum Wheat, NSGC Lr
Wheat AB, Carotenoid QTL, 2017
Wheat, Yr genes and QTL
Probe
CFA2170
Possible Orthologs
Xcfa2170-1D
[ Show all 8 ]



Probe
CFA2170
Locus
Xcfa2170-3B
[ Show all 10 ]
Reference
ReferenceSourdille P et al. (2001) Improvement of the genetic maps of wheat using new microsatellite markers Plant & Animal Genome IX Abstracts 167.
Remarks
Quality Score = B
Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems)
Amplifies motif: (GA)31
Regularity of motif is imperfect
Type
PCR
SSR
PCR primers
Forward 5' TGGCAAGTAACATGAACGGA 3'
Reverse 5' ATGTCATTCATGTTGCCCCT 3'
SSR size
199
Amplification Conditions
5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group
3A/3B
Source Species
Triticum urartu
Data Source
Sourdille, Pierre



Locus for Probe
cfa2170-3A
Type
Microsatellite
Map
Wheat_AB, Meridiano x Claudio 3A_32.3
Wheat_AB_2015_Consensus-3A148
Wheat_Yr_2021-3A158.11
[ Show Nearby Loci ]
Map Data
Wheat, Yr Update, 2021
Wheat_AB, Meridiano x Claudio
Wheat_AB_2015_Consensus
Probe
CFA2170
Reference
ReferenceLowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157.
Possible Orthologs
cfa2170
[ Show all 8 ]



Locus for Probe
cfa2170-3B
Type
Microsatellite
Map
Wheat_AB, Colosseo x Lloyd 3B123.7
Wheat_AB, Meridiano x Claudio 3B_214
Wheat_AB_2015_Consensus-3B158.5
Wheat_Yr_2021-3B153.37
[ Show Nearby Loci ]
In QTL
QYI.Col-3B.2
Map Data
Wheat, Yr Update, 2021
Wheat_AB, Colosseo x Lloyd
Wheat_AB, Meridiano x Claudio
Wheat_AB_2015_Consensus
Probe
CFA2170
Reference
ReferenceLowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157.
Possible Orthologs
cfa2170
[ Show all 8 ]



Locus for Probe
Sr35
Type
Gene
Chromosome
3A
Chromosome Arm
3AL
Map
Triticum-Genes-3A40
Wheat-2014-Consensus-Ug99-Update_3A114
[ Show Nearby Loci ]
Map Data
Wheat genes
Wheat-2014-Consensus-Ug99-Update
2 Point Data
Centromere/Sr35#1
Sr35/R2#1
Probe
AK335187
[ Show all 9 ]
Associated Gene
Sr35 (Triticum)
Gene Class
Reaction to Puccinia graminis Pers.
Reference
ReferenceYu L et al. (2014) A consensus map for Ug99 stem rust resistance loci in wheat. Theoretical and Applied Genetics 127:1561-1581.
ReferenceSaintenac C et al. (2013) Identification of Wheat Gene Sr35 That Confers Resistance to Ug99 Stem Rust Race Group Science 341:783-786.
ReferenceZhang W et al. (2010) Genetic Maps of Stem Rust Resistance Gene Sr35 in Diploid and Hexaploid Wheat Crop Science 50:2464-2474.
ReferenceMcIntosh RA et al. (1984) Cytogenetical studies in wheat. XIII. Sr35 - a third gene from Triticum monococcum for resistance to Puccinia graminis tritici. Zeitschrift fur Pflanzenzuchtung 92:1-14.
ReferenceZhang W et al. MAS Wheat. Bringing Genomics to the Wheat Fields. Disease resistance. Stem Rust Resistance. Sr35 MAS Wheat. Marker Assisted Selection in Wheat.
Remark
The location on the 2014 Ug99 Consensus Map is approximate.



Locus for Probe
Xcfa2170-1D
Type
Microsatellite
Map
Ta-Synthetic/Opata-GPW-1D231.5
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata, GPW
Probe
CFA2170
Possible Orthologs
cfa2170
[ Show all 8 ]



Locus for Probe
Xcfa2170-3A
Type
Microsatellite
Map
P91193D1/P92201D5-3A126.9
T.b.xT.m.-3A202.4
Wheat, UC1110 x PI610750 3A143.7
Wheat_Brittle_culm_2012-3A3.7
[ Show Nearby Loci ]
Map Data
T. boeoticum x monococcum
Wheat, 2012, Brittle culm
Wheat, P91193D1 x P92201D5
Wheat, UC1110 x PI610750
Probe
CFA2170
Reference
ReferenceLowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157.
Possible Orthologs
cfa2170
[ Show all 8 ]



Locus for Probe
Xcfa2170-3A.1
Type
Microsatellite
Chromosome
3A
Chromosome Arm
3AL
Map
Triticum-AxF-3A145.3
[ Show Nearby Loci ]
Map Data
Wheat, Arina x Forno
Species
Triticum aestivum
Probe
CFA2170
Reference
ReferencePaillard S et al. (2003) An integrative genetic linkage map of winter wheat (Triticum aestivum L.) Theoretical and Applied Genetics 107:1235-1242.
Possible Orthologs
cfa2170
[ Show all 8 ]



Locus for Probe
Xcfa2170-3A.2
Type
Microsatellite
Chromosome
3A
Chromosome Arm
3AL
Map
Triticum-AxF-3A145.6
[ Show Nearby Loci ]
Map Data
Wheat, Arina x Forno
Species
Triticum aestivum
Probe
CFA2170
Reference
ReferencePaillard S et al. (2003) An integrative genetic linkage map of winter wheat (Triticum aestivum L.) Theoretical and Applied Genetics 107:1235-1242.
Possible Orthologs
cfa2170
[ Show all 8 ]



Locus for Probe
Xcfa2170-3B
Type
Microsatellite
Chromosome
3B
Chromosome Arm
3BL
Map
Chinese_Spring_Deletion_SSR_3B0.815
[ Show all 6 ]
[ Show Nearby Loci ]
Breakpoint Interval
3BL7-0.63-1.00
Map Data
Wheat, Arina x Forno
[ Show all 6 ]
Species
Triticum aestivum
Probe
CFA2170
Reference
ReferenceLowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157.
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
ReferencePaillard S et al. (2003) An integrative genetic linkage map of winter wheat (Triticum aestivum L.) Theoretical and Applied Genetics 107:1235-1242.
Possible Orthologs
cfa2170
[ Show all 8 ]



Locus for Probe
Xcfa2170a
Type
Microsatellite
Chromosome
1D
Map
Wheat-Composite2004-1D2
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Probe
CFA2170
Possible Orthologs
cfa2170
[ Show all 8 ]

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.