Query (optional)   in Class  

GrainGenes Marker Report: CFA2193

[Submit comment/correction]

Probe
CFA2193
Locus
Xcfa2193-3A
Xcfa2193
Sr35
cfa2193
cfa2193-3A
Reference
ReferenceSourdille P et al. (2001) Improvement of the genetic maps of wheat using new microsatellite markers Plant & Animal Genome IX Abstracts 167.
Remarks
Quality Score = B
Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems)
Amplifies motif: (GT)12
Regularity of motif is perfect
Type
PCR
SSR
PCR primers
Forward 5' ACATGTGATGTGCGGTCATT 3'
Reverse 5' TCCTCAGAACCCCATTCTTG 3'
SSR size
195
Amplification Conditions
5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group
3A
Source Species
Triticum urartu
Data Source
Sourdille, Pierre



Locus for Probe
cfa2193
Type
Microsatellite
Map
Durum Wheat, NSGC Lr 3A132.5
Wheat, Yr genes and QTL 3A66.7
Wheat_Yr_2021-3A144.26
[ Show Nearby Loci ]
In QTL
QSpsm.KoxSv-3A
QTkw.KoxSv-3A
QTw.IDuWUE-3A.2
Map Data
Durum Wheat, NSGC Lr
Wheat, Yr genes and QTL
Wheat, Yr Update, 2021
Probe
CFA2193
Reference
ReferenceLowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157.
Possible Orthologs
Xcfa2193
Xcfa2193-3A
cfa2193-3A



Locus for Probe
cfa2193-3A
Type
Microsatellite
Map
Wheat_AB, Latino x MG5323 3A141.5
Wheat_AB_2015_Consensus-3A132.5
[ Show Nearby Loci ]
Map Data
Wheat_AB, Latino x MG5323
Wheat_AB_2015_Consensus
Probe
CFA2193
Possible Orthologs
Xcfa2193
Xcfa2193-3A
cfa2193



Locus for Probe
Sr35
Type
Gene
Chromosome
3A
Chromosome Arm
3AL
Map
Triticum-Genes-3A40
Wheat-2014-Consensus-Ug99-Update_3A114
[ Show Nearby Loci ]
Map Data
Wheat genes
Wheat-2014-Consensus-Ug99-Update
2 Point Data
Centromere/Sr35#1
Sr35/R2#1
Probe
AK335187
[ Show all 9 ]
Associated Gene
Sr35 (Triticum)
Gene Class
Reaction to Puccinia graminis Pers.
Reference
ReferenceYu L et al. (2014) A consensus map for Ug99 stem rust resistance loci in wheat. Theoretical and Applied Genetics 127:1561-1581.
ReferenceSaintenac C et al. (2013) Identification of Wheat Gene Sr35 That Confers Resistance to Ug99 Stem Rust Race Group Science 341:783-786.
ReferenceZhang W et al. (2010) Genetic Maps of Stem Rust Resistance Gene Sr35 in Diploid and Hexaploid Wheat Crop Science 50:2464-2474.
ReferenceMcIntosh RA et al. (1984) Cytogenetical studies in wheat. XIII. Sr35 - a third gene from Triticum monococcum for resistance to Puccinia graminis tritici. Zeitschrift fur Pflanzenzuchtung 92:1-14.
ReferenceZhang W et al. MAS Wheat. Bringing Genomics to the Wheat Fields. Disease resistance. Stem Rust Resistance. Sr35 MAS Wheat. Marker Assisted Selection in Wheat.
Remark
The location on the 2014 Ug99 Consensus Map is approximate.



Locus for Probe
Xcfa2193
Type
Microsatellite
Chromosome
3A
Map
Wheat, UC1110 x PI610750 3A130.3
Wheat-Composite2004-3A171
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Wheat, UC1110 x PI610750
Probe
CFA2193
Reference
ReferenceLowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157.
Possible Orthologs
Xcfa2193-3A
cfa2193
cfa2193-3A



Locus for Probe
Xcfa2193-3A
Type
Microsatellite
Chromosome
3A
Map
CS/SQ1-3A115.7
[ Show all 6 ]
[ Show Nearby Loci ]
Map Data
Durum wheat, Kofa x UC1113
[ Show all 6 ]
Probe
CFA2193
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
Possible Orthologs
Xcfa2193
cfa2193
cfa2193-3A

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.