Query (optional)   in Class  

GrainGenes Marker Report: CFD15

[Submit comment/correction]

Probe
CFD15
Locus
Xcfd15-1A
[ Show all 11 ]
Reference
ReferenceGuyomarc'h H et al. (2002) Characterisation of polymorphic microsatellite markers from Aegilops tauschii and transferability to the D-genome of bread wheat Theoretical and Applied Genetics 104:1164-1172.
Remarks
Quality Score = B
Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems)
Amplifies motif: (CT)20(TGTA)3
Regularity of motif is perfect
Type
PCR
SSR
PCR primers
Forward 5' CTCCCGTATTGAGCAGGAAG 3'
Reverse 5' GGCAGGTGTGGTGATGATCT 3'
SSR size
179
Amplification Conditions
5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group
1A/1D
Source Species
Aegilops tauschii
Data Source
Sourdille, Pierre



Locus for Probe
cfd15
Type
Microsatellite
Map
Wheat, Yr genes and QTL 1A10.7
Wheat, Yr genes and QTL 1D8.8
Wheat_Consensus_2014_Ug99_Rust_1A19.43
Wheat_Consensus_2014_Ug99_Rust_1D16.22
[ Show Nearby Loci ]
Map Data
Wheat, Yr genes and QTL
Wheat_Consensus_2014_Ug99_Rust
Probe
CFD15
Possible Orthologs
Xcfd15
[ Show all 9 ]



Locus for Probe
cfd15(2)
Type
Microsatellite
Map
Wheat_Consensus_2014_Ug99_Rust_1A19.65
[ Show Nearby Loci ]
Map Data
Wheat_Consensus_2014_Ug99_Rust
Probe
CFD15
Possible Orthologs
Xcfd15
[ Show all 9 ]



Locus for Probe
cfd15-1A.1
Type
Microsatellite
Map
Wheat-2014-Consensus-Ug99-Update_1A19.43
[ Show Nearby Loci ]
Map Data
Wheat-2014-Consensus-Ug99-Update
Probe
CFD15
Possible Orthologs
Xcfd15
[ Show all 9 ]



Locus for Probe
cfd15-1A.2
Type
Microsatellite
Map
Wheat-2014-Consensus-Ug99-Update_1A19.65
[ Show Nearby Loci ]
Map Data
Wheat-2014-Consensus-Ug99-Update
Probe
CFD15
Possible Orthologs
Xcfd15
[ Show all 9 ]



Locus for Probe
cfd15-1D
Type
Microsatellite
Map
Wheat-2014-Consensus-Ug99-Update_1D16.22
Wheat_Yr_2021-1D17.59
[ Show Nearby Loci ]
Map Data
Wheat, Yr Update, 2021
Wheat-2014-Consensus-Ug99-Update
Probe
CFD15
Possible Orthologs
Xcfd15
[ Show all 9 ]



Locus for Probe
Sr33
Type
Gene
Trait
Chromosome
1D
Chromosome Arm
1DS
1S
Map
1DS, Ae. tauschii30.7
[ Show all 6 ]
[ Show Nearby Loci ]
Map Data
1DS, Ae. tauschii
Triticeae consensus
Wheat genes
Wheat, Synthetic x Opata  [ GBrowser ]
Wheat-2014-Consensus-Ug99-Update
2 Point Data
Centromere/Sr33#1
Rg2/Sr33#1
Sr33/Gli-D1#1
Species
Aegilops tauschii
Triticum aestivum
Probe
ABC156
BARC152
CFD15
Associated Gene
Sr33 (Aegilops)
Sr33 (Triticum)
Gene Class
Reaction to Puccinia graminis Pers.
Reference
ReferenceYu L et al. (2014) A consensus map for Ug99 stem rust resistance loci in wheat. Theoretical and Applied Genetics 127:1561-1581.
[ Show all 6 ]
Data Source
Matthews, David E.
Remark
For map 'Wheat, Synthetic x Opata', position approximated from mapping in another population.
Trait marker abc156, whs179a
Nearby marker on Composite map: Xabc156b, Xwhs179.1
Position on Composite map estimated by GrainGenes.
The location on the 2014 Ug99 Consensus Map is approximate.



Locus for Probe
Xcfd15
Type
Microsatellite
Chromosome
1A
1B
Map
Svevo/Ciccio-1B4.1
Wheat, Avalon x Cadenza 1A23
Wheat, Avalon x Cadenza 1D16.9
Wheat-Composite2004-1A23
Wheat-Composite2004-1B7
[ Show Nearby Loci ]
Map Data
Durum wheat, Svevo x Ciccio
Wheat, Avalon x Cadenza
Wheat, Composite, 2004
Probe
CFD15
Possible Orthologs
Xcfd15-1A
[ Show all 9 ]



Locus for Probe
Xcfd15-1A
Type
Microsatellite
Chromosome
1A
Map
Louise/Penawawa-1A25
Ta-Courtot/CS-GPW-1A15.1
Ta-SSR-2004-1A24.6
[ Show Nearby Loci ]
Map Data
Wheat, Consensus SSR, 2004
Wheat, Courtot x Chinese Spring, GPW
Wheat, Louise x Penawawa
Probe
CFD15
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
Possible Orthologs
Xcfd15
[ Show all 9 ]



Locus for Probe
Xcfd15-1B
Type
Microsatellite
Map Data
Durum wheat, Svevo x Ciccio
Probe
CFD15
Possible Orthologs
Xcfd15
[ Show all 9 ]



Locus for Probe
Xcfd15-1D
Type
Microsatellite
Chromosome
1D
Chromosome Arm
1DS
Map
Chinese_Spring_Deletion_SSR_1D-0.24
Ta-SSR-2004-1D23.2
Ta-Synthetic/Opata-GPW-1D28.1
Triticum-AxF-1D19.5
[ Show Nearby Loci ]
Breakpoint Interval
C-1DS3-0.48
Map Data
Wheat, Arina x Forno
Wheat, Consensus SSR, 2004
Wheat, Physical, SSR
Wheat, Synthetic x Opata, GPW
Species
Triticum aestivum
Probe
CFD15
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
ReferencePaillard S et al. (2003) An integrative genetic linkage map of winter wheat (Triticum aestivum L.) Theoretical and Applied Genetics 107:1235-1242.
Possible Orthologs
Xcfd15
[ Show all 9 ]



Locus for Probe
cfd15-1A
Type
Microsatellite
Chromosome
1A
Map
Wheat_Yr_2021-1A21.63
[ Show Nearby Loci ]
Map Data
Wheat, Yr Update, 2021
Probe
CFD15
Possible Orthologs
Xcfd15
[ Show all 9 ]

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.