Query (optional)   in Class  

GrainGenes Marker Report: CFD49

[ Submit comment/correction ]

Probe
CFD49
Locus
Xcfd49-6D
Xcfd49
cfd49-6D
SrTA10187
cfd49
Reference
ReferenceOlson EL et al. (2013) Introgression of stem rust resistance gene SrTA10187 and SrTA10171 from Aegilops tauschii to wheat Theoretical and Applied Genetics 126:2477-2484.
ReferenceGuyomarc'h H et al. (2002) Characterisation of polymorphic microsatellite markers from Aegilops tauschii and transferability to the D-genome of bread wheat Theoretical and Applied Genetics 104:1164-1172.
ReferenceMAS Wheat. Bringing Genomics to the Wheat Fields. Disease Resistance. Stem Rust Resistance. SrTA10187 MAS Wheat. Marker Assisted Selection in Wheat.
Remarks
Quality Score = A
Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems)
Amplifies motif: (GA)33
Regularity of motif is imperfect
Type
PCR
SSR
PCR primers
Forward 5' TGAGTTCTTCTGGTGAGGCA 3'
Reverse 5' GAATCGGTTCACAAGGGAAA 3'
SSR size
214
Amplification Conditions
5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group
6D
Source Species
Aegilops tauschii
Data Source
Sourdille, Pierre



Locus for Probe
cfd49-6D
Map
KPxKC-6D
[ Show Nearby Loci ]
Map Data
Wheat, Klein Proteo x Klein Chaja
Probe
CFD49



Locus for Probe
SrTA10187
Type
Gene
Chromosome
6D
Chromosome Arm
6DS
Map
Wheat-2014-Consensus-Ug99-Update_6D5
[ Show Nearby Loci ]
Map Data
Wheat-2014-Consensus-Ug99-Update
Probe
BARC173
CFD49
PSP3200
Associated Gene
SrTA10187 (Triticum)
Gene Class
Reaction to Puccinia graminis Pers.
Reference
ReferenceYu L et al. (2014) A consensus map for Ug99 stem rust resistance loci in wheat. Theoretical and Applied Genetics 127:1561-1581.
ReferenceOlson EL et al. (2013) Introgression of stem rust resistance gene SrTA10187 and SrTA10171 from Aegilops tauschii to wheat Theoretical and Applied Genetics 126:2477-2484.
ReferenceMAS Wheat. Bringing Genomics to the Wheat Fields. Disease Resistance. Stem Rust Resistance. SrTA10187 MAS Wheat. Marker Assisted Selection in Wheat.
Remark
The location on the 2014 Ug99 Consensus Map is approximate.



Locus for Probe
cfd49
Type
Microsatellite
Map
Wheat, Yr genes and QTL 6D13.9
[ Show Nearby Loci ]
Map Data
Wheat, Yr genes and QTL
Probe
CFD49
Possible Orthologs
Xcfd49
Xcfd49-6D
Xcfd49a



Locus for Probe
Xcfd49
Type
Microsatellite
Chromosome
6D
Map
Ta-NxW-6D0
Wheat-Composite2004-6D15
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Wheat, Nanda2419 x Wangshuibai
Probe
CFD49
Possible Orthologs
Xcfd49-6D
cfd49
Xcfd49a



Locus for Probe
Xcfd49-6D
Type
Microsatellite
Chromosome
6D
Chromosome Arm
6DS
Map
Chinese_Spring_Deletion_SSR_6D-0.995
[ Show all 6 ]
[ Show Nearby Loci ]
Breakpoint Interval
6DS6-0.99-1.00
Map Data
Wheat, Arina x Forno
[ Show all 6 ]
Species
Triticum aestivum
Probe
CFD49
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
ReferencePaillard S et al. (2003) An integrative genetic linkage map of winter wheat (Triticum aestivum L.) Theoretical and Applied Genetics 107:1235-1242.
Possible Orthologs
Xcfd49
cfd49
Xcfd49a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.