Query (optional)   in Class  

GrainGenes Marker Report: DUPW167

[ Submit comment/correction ]

Probe
DUPW167
Locus
XDuPw167
Xdupw167-6A
dupw167
dupw167-6A
Xdupw167
Reference
ReferenceEujayl I et al. (2002) Isolation of EST-derived microsatellite markers for genotyping the A and B genomes of wheat Theoretical and Applied Genetics 104:399-407.
Type
SSR
EST
PCR primers
5' CGGAGCAAGGACGATAGG
3' CACCACACCAATCAGGAACC



Locus for Probe
dupw167
Type
Microsatellite
In QTL
QHd.IDuWUE-6A.4
QHt.IDuWUE-6A.3
Probe
DUPW167
Possible Orthologs
Xdupw167-6A
dupw167-6A
Xdupw167



Locus for Probe
dupw167-6A
Type
Microsatellite
Map
Wheat_AB, Colosseo x Lloyd 6A128.9
[ Show Nearby Loci ]
Map Data
Wheat_AB, Colosseo x Lloyd
Probe
DUPW167
Possible Orthologs
Xdupw167-6A
Xdupw167
dupw167



Locus for Probe
Xdupw167
Type
Microsatellite
Map
Wheat, Avalon x Cadenza 6A152.1
[ Show Nearby Loci ]
Map Data
Wheat, Avalon x Cadenza
Probe
DUPW167
Possible Orthologs
Xdupw167-6A
dupw167-6A
dupw167



Locus for Probe
XDuPw167
Type
Microsatellite
Chromosome
6A
Chromosome Arm
6AL
Map
Tt-LxG-6A161.2
[ Show Nearby Loci ]
Map Data
T. turgidum, Langdon x G18-16
Probe
DUPW167



Locus for Probe
Xdupw167-6A
Type
Microsatellite
Map
Kofa/UC1113-6A125.5
[ Show Nearby Loci ]
Map Data
Durum wheat, Kofa x UC1113
Probe
DUPW167
Possible Orthologs
dupw167-6A
Xdupw167
dupw167

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.