Query (optional)   in Class  

GrainGenes Marker Report: DsT-33

[ Printable Version ]  [ Submit comment/correction ]

Locus
DsT-33
Type
Insertion
Chromosome
5H
Map
Hordeum-OWB-2004-5H203.4
Hordeum-OWB-2005-5H207.5
Hordeum-OWB-OPA2008-5H225.842
Hv-Integrated2009-5H163.1
[ Show Nearby Loci ]
Map Data
Barley, Integrated, Marcel 2009
Barley, OWB, 2004
Barley, OWB, 2005
Barley, OWB, OPA2008
Species
Hordeum vulgare
Probe
TNP-33
Reference
ReferenceSzucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140.
Remark
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = L9Oregon Wolfe Barleys x Vada,Oregon Wolfe Barleys



Probe for Locus
TNP-33
Locus
DsT-33
General Remarks
Primers amplify in OWBs and Golden Promise
Type
PCR
STS
PCR primers
TNP-33-24F 5' GCACACATATTATCATGAAAAAGAGC
TNP-33-348R 5' ACCCCAAATGAGTTTCGATG
Source Species
Hordeum vulgare