Query (optional)   in Class  

GrainGenes Marker Report: GBM1108

[Submit comment/correction]

Locus
GBM1108
Type
Microsatellite
Map
Hv-Integrated2009-1H74.2
[ Show Nearby Loci ]
Map Data
Barley, Integrated, Marcel 2009
Probe
GBM1108
Remark
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Oregon Wolfe Barleys



Probe
GBM1108
Locus
GBM1108
GBM1108-1H
Reference
ReferenceVarshney RK et al. (2006) Genetic mapping and BAC assignment of EST-derived SSR markers shows non-uniform distribution of genes in the barley genome Theoretical and Applied Genetics 113:239-250.
Remarks
Clone HI01G10w
PCR primers
GAAAAGGAACGAAGGGGAAC
GCCGCGAGTGCTACAAGT
Amplification Conditions
3 min at 94 deg C; 45 cycles with 30 sec at 94 deg C, 30 sec at 60 deg C (touchdown of 0.5 deg C / cycle for initial 10 cycles - final annealing of 55 deg C for remaining 35 cycles), 30 sec at 72 deg C; and a final extension step of 5 min at 72 deg C
Sequence
BQ660193
DNA Library
IPK-HI
Source Species
Hordeum vulgare
Source Germplasm
Barke (barley)
Data Source
Stein, Nils2006.10



Locus for Probe
GBM1108-1H
Type
Microsatellite
Map
Hv-Consensus2006-Stein-1H75.5
Hv-DxR-Stein-1H75.11
[ Show Nearby Loci ]
Map Data
Barley, Consensus 2006, Stein
Barley, OWB, Stein2006
Probe
GBM1108

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.