Query (optional)   in Class  

GrainGenes Marker Report: GBM1121

[ Printable Version ]  [ Submit comment/correction ]

Locus
GBM1121
Type
Microsatellite
Chromosome
2H
Map
Hordeum-Consensus2007-SSR-2H29.46
Hv-Consensus2006-Marcel-2H29.46
Hv-Integrated2009-2H27.1
Hv-L94/Vada-2006-2H24.47
[ Show Nearby Loci ]
Map Data
Barley, Consensus 2006, Marcel
Barley, Consensus 2007, SSR
Barley, Integrated, Marcel 2009
Barley, L94 x Vada, 2006
Species
Hordeum vulgare
Probe
GBM1121
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceVarshney RK et al. (2006) Genetic mapping and BAC assignment of EST-derived SSR markers shows non-uniform distribution of genes in the barley genome Theoretical and Applied Genetics 113:239-250.
Remark
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
[ Show all 7 ]



Probe
GBM1121
Locus
GBM1121
GBM1121-2H
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceVarshney RK et al. (2006) Genetic mapping and BAC assignment of EST-derived SSR markers shows non-uniform distribution of genes in the barley genome Theoretical and Applied Genetics 113:239-250.
Remarks
Primer sequences for this SSR to be released in the public domain soon (noted: September 2006). Those interested should contact Andreas Graner
Clone HI01O22T
Type
SSR
PCR primers
ACCACCCCCATCCATCAG
GACTGCACCTTGTAGCCGAT
Amplification Conditions
3 min at 94 deg C; 45 cycles with 30 sec at 94 deg C, 30 sec at 60 deg C (touchdown of 0.5 deg C / cycle for initial 10 cycles - final annealing of 55 deg C for remaining 35 cycles), 30 sec at 72 deg C; and a final extension step of 5 min at 72 deg C
Sequence
BQ462765
DNA Library
IPK-HI
Source Species
Hordeum vulgare
Source Germplasm
Barke (barley)
Data Source
Graner, Andreas
Stein, Nils2006.10



Locus for Probe
GBM1121-2H
Type
Microsatellite
Map
Hv-Consensus2006-Stein-2H26.2
Hv-SxM-Stein-2H23.72
[ Show Nearby Loci ]
Map Data
Barley, Consensus 2006, Stein
Barley, SxM, Stein2006
Probe
GBM1121