Query (optional)   in Class  

GrainGenes Marker Report: GBM1139

[ Printable Version ]  [ Submit comment/correction ]

Locus
GBM1139
Type
Microsatellite
Chromosome
3H
Map
Barley, B73xCPI-3H46.1
Hordeum-Consensus2007-SSR-3H52.02
Hv-Consensus2006-Marcel-3H52.02
Hv-Integrated2009-3H63.8
Hv-L94/Vada-2006-3H57.2
[ Show Nearby Loci ]
Map Data
Barley, B73xCPI
Barley, Consensus 2006, Marcel
Barley, Consensus 2007, SSR
Barley, Integrated, Marcel 2009
Barley, L94 x Vada, 2006
Species
Hordeum vulgare
Probe
GBM1139
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceVarshney RK et al. (2006) Genetic mapping and BAC assignment of EST-derived SSR markers shows non-uniform distribution of genes in the barley genome Theoretical and Applied Genetics 113:239-250.
Remark
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
[ Show all 7 ]



Probe
GBM1139
Locus
GBM1139
GBM1139-3H
Reference
ReferenceHearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391.
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceVarshney RK et al. (2006) Genetic mapping and BAC assignment of EST-derived SSR markers shows non-uniform distribution of genes in the barley genome Theoretical and Applied Genetics 113:239-250.
Remarks
Primer sequences for this SSR to be released in the public domain soon (noted: September 2006). Those interested should contact Andreas Graner
Clone HP01B24w
Type
SSR
EST
PCR primers
GCACACACAATGGGAAACAG
CGACTAATGAGGGAAGGCAG
Amplification Conditions
3 min at 94 deg C; 45 cycles with 30 sec at 94 deg C, 30 sec at 60 deg C (touchdown of 0.5 deg C / cycle for initial 10 cycles - final annealing of 55 deg C for remaining 35 cycles), 30 sec at 72 deg C; and a final extension step of 5 min at 72 deg C
Sequence
BQ661747
DNA Library
IPK-HP
Source Species
Hordeum vulgare
Source Germplasm
Barke (barley)
Data Source
Graner, Andreas
Stein, Nils2006.10



Locus for Probe
GBM1139-3H
Type
Microsatellite
Map
Hv-Consensus2006-Stein-3H69
Hv-SxM-Stein-3H50.83
[ Show Nearby Loci ]
Map Data
Barley, Consensus 2006, Stein
Barley, SxM, Stein2006
Probe
GBM1139