Query (optional)   in Class  

GrainGenes Marker Report: GBM1226

[ Printable Version ]  [ Submit comment/correction ]

Locus
GBM1226
Type
Microsatellite
Chromosome
3H
Map
Hordeum-Consensus2007-SSR-3H102.22
Hv-Consensus2006-Marcel-3H102.22
Hv-Integrated2009-3H117.4
[ Show Nearby Loci ]
Map Data
Barley, Consensus 2006, Marcel
Barley, Consensus 2007, SSR
Barley, Integrated, Marcel 2009
Barley, Vada x SusPtrit
Species
Hordeum vulgare
Probe
GBM1226
Reference
ReferenceMarcel TC et al. (2007) A high-density consensus map of barley to compare the distribution of QTLs for partial resistance to Puccinia hordei and of defence gene homologues. Theoretical and Applied Genetics 114:487-500.
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
Remark
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
[ Show all 8 ]



Probe
GBM1226
Locus
GBM1226
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceVarshney RK et al. (2006) Genetic mapping and BAC assignment of EST-derived SSR markers shows non-uniform distribution of genes in the barley genome Theoretical and Applied Genetics 113:239-250.
Remarks
Primer sequences for this Microsatellite to be released in the public domain soon (noted: September 2006). Those interested should contact Andreas Graner
Type
PCR
SSR
PCR primers
CGTTCCCACTTGGAAATTGA
GTGACGGAAGGCAGAGTAGG
Source Species
Hordeum vulgare
Data Source
Graner, Andreas