Query (optional)   in Class  

GrainGenes Marker Report: GBMS244

[ Printable Version ]  [ Submit comment/correction ]

Locus
GBMS244
Type
Microsatellite
Chromosome
2H
Map
Hordeum-Consensus2007-SSR-2H102.68
Hordeum-IxF-SSR-2H133.4
Hv-Consensus2006-Marcel-2H102.68
Hv-Integrated2009-2H97
[ Show Nearby Loci ]
Map Data
Barley, Consensus 2006, Marcel
Barley, Consensus 2007, SSR
Barley, Igri x Franka, SSR
Barley, Integrated, Marcel 2009
Species
Hordeum vulgare
Probe
GBMS244
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceLi JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Remark
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
[ Show all 8 ]



Probe
GBMS244
Locus
GBMS244
Reference
ReferenceHayden MJ et al. (2008) Multiplex-Ready PCR: A new method for multiplexed SSR and SNP genotyping BMC Genomics 9:80.
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceLi JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Remarks
Insert contains repeat (GT)10
Primer sequences for this SSR are proprietary. Those interested should contact Marion Roeder.
Primer sequences for this SSR are proprietary, those interested should contact Marion Roeder
Type
PCR
SSR
PCR primers
Forward ACCTGAAAAGTCATGGTGGC
Reverse ACAGCCAATGACAAGCGAG
Source Species
Hordeum vulgare
Source Germplasm
Franka (barley)
Data Source
Roeder, Marion S.